We narrowed to 16,166 results for: grna
-
Plasmid#69296PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
PX458_AHR_2
Plasmid#101077PurposeEncodes gRNA for 3' target of human AHRDepositorPublicationInsertgRNA against AHR (AHR Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKCcas9dO
Plasmid#62552PurposeHigh efficiency Streptomyces genome editing by CRISPR/Cas9 systemDepositorInsertsScocas9
sgRNA ()
act-orf4 homology arm
UseCRISPR; Bacterial genome editingExpressionBacterialPromoterj23119 and ptipAAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB700-TTN-Puro
Plasmid#128323PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human TTN for activation
ExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC365
Plasmid#91214Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, tRNA processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGMV-gSWEET4
Plasmid#112796PurposeUniversal BeYDV-derived vector with gRNAs targeting the VviSWEET4 geneDepositorInsertgRNA pair targeting VviSWEET4
UseCRISPRExpressionPlantAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-Arf1 gRNA
Plasmid#246572PurposeCRISPR vector co-expressing Cas9 and a mouse Arf1 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd1/2 gRNA
Plasmid#246562PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd1/2 gRNA (conserved region)DepositorInsertFzd1/2 gRNA
UseCRISPRPromoterU6Available sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Flrt2 gRNA
Plasmid#246567PurposeCRISPR vector co-expressing Cas9 and a mouse Flrt2 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Template ORF0
Plasmid#240304PurposeDonor:smFP-V5 KO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp KI;Empty
Plasmid#240302PurposeEmpty vectorDepositorInsertEmpty gRNA
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV 3xgRNA KO;Template
Plasmid#240310PurposeKO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPELO #2
Plasmid#229020PurposeExpression of a CRISPRi doxycycline inducible guide targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 mBAX
Plasmid#129577PurposeCRISPR deletion of murine BAXDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTRm
Plasmid#127197PurposepGTRm is the template plasmid for PCR & golden gate assembly driven generation of polycistronic tRNA-gRNA sequencesDepositorInserttRNA-gRNA PCR template
UseTemplate plasmid for generation of golden gate pc…PromoterNoneAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133A
Plasmid#69275PurposeGolden Gate entry vector; 3rd gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by