We narrowed to 11,452 results for: AGA
-
Plasmid#141320PurposePlasmid to carry out IVT of RfxCas13d (human codon-optimized)DepositorInsertRfx-Cas13d
UseCRISPRTagsHAAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-SMARCA4
Plasmid#65391PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
SMARCA2-GFP
Plasmid#65390PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-HOXA9
Plasmid#237639PurposeFor overexpression of mEGFP-NUP98-HOXA9DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A
Plasmid#239212PurposeExpresses CDK11A in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-TAF1
Plasmid#65395PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-mRuby3-Gal8-P2A-Zeo
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Synthetic, Human)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRL_SRSF2_P95H_mCherry
Plasmid#84023Purposeexpression of SRSF2 mutant in mammalian cellsDepositorInsertSRSF2 (SRSF2 Human)
UseLentiviralTags2TA-mCherry and FlagExpressionMammalianMutationP95HPromoterPGKAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10
Plasmid#237640PurposeFor overexpression of mEGFP-NUP98-DDX10DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only