We narrowed to 16,640 results for: sgrna
-
Plasmid#159793PurposeS. pyogenes sgRNA collocated with pegRNA targeting mouse HOXD13 geneDepositorInsertspacer of sgRNA targeting HOXD13 gene (HOXD13 Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human BLIMP1 sgRNA
Plasmid#59724PurposePlasmid encoding sgRNA to generate BLIMP1 knockout mutant human cellsDepositorInserthBLIMP1 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 1
Plasmid#70652PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
px459-Rheb sgRNA
Plasmid#133768PurposeExpresses Cas9 and human Rheb sgRNADepositorInsertRheb sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBR322-sgRNA-pvc18-20
Plasmid#243747PurposePVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNADepositorInsertvegfa sgRNA-pvc18-20
UseTagsExpressionBacterialMutationPromoterAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA1 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA2 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNS1D-sgRNA9-SpR
Plasmid#191092PurposeaTc inducible gRNA expression plasmid with BbsI sites for Golden Gate insertion of crRNA oligos and homology arms for genome integration at NS1D in Synechococcus sp. PCC 7002DepositorTypeEmpty backboneUseCRISPRTagsExpressionBacterialMutationPromotertetAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only