173,387 results
-
Plasmid#232174PurposeExpression of replication/capsid proteins for AAV serotype 1DepositorInsertRep52, VP1 of AAV-1
UseAAVExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV1)
Viral Prep#162377-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUAS-NanoLuc
Plasmid#87696PurposeGal4VP16 driven expression of NanoLucDepositorInsertNanoLuc
Tagsnuclear localization signalExpressionMammalianAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo
Plasmid#139449PurposeLentiviral vector with gRNA scaffold and neomycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-CMV-bArrestin2-TEV
Plasmid#107245PurposeVector for preparation of stable cell lines expressing Barrestin2-TEV fusion protein in lieu of the HTLA cell line.DepositorInsertARRB2
TagsTEV(NIA), tobacco etch virus NIAExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-5
Plasmid#104583PurposeContains human IgG1 CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRVL-4
Plasmid#104582PurposeContains human kappa CL domain, for cloning of antibody VL domains using SapI restriction enzyme.DepositorInsertHuman CL kappa
ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hChR2(H134R)-mCherry (AAV9)
Viral Prep#26976-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hChR2(H134R)-mCherry (#26976). In addition to the viral particles, you will also receive purified pAAV-hSyn-hChR2(H134R)-mCherry plasmid DNA. Synapsin-driven, humanized channelrhodopsin H134R mutant, fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only