We narrowed to 6,333 results for: nls
-
Plasmid#82620PurposeExpresses NLS-tdiRFP-2A-LBR in mammalian cellsDepositorAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pGinB-8X(GGS)-dCas9-FLAG-NLS_SpecR
Plasmid#81206PurposeCMV promoter driving expression of GinB catalytic domain fused with linker to dCas9 in the order shown. Has a FLAG and NLS tag on the c-terminus. Spec resistanceDepositorInsertpGinB-8X(GGS)-dCas9-FLAG-NLS
ExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-HOXD13-IDR-YFP-NLS
Plasmid#145277PurposeMammalian Expression of Nuclear HOXD13 IDR-YFP with SV40 NLSDepositorInsertHOXD13-IDR (HOXD13 Human)
ExpressionMammalianAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106352PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Construct 7 - CMVp-Cas9-3xNLS-HSVpA
Plasmid#81247PurposeExpresses Cas9 fused to 3xNLS driven by CMV promoter. For mammalian cell expressionDepositorInsertCas9-3xNLS
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGGEV_4'_+nls-mCherry-Flag-_+1_BK+
Plasmid#49313PurposeGolden Gate entry vector: Position 4', Flag tagged nls-mCherry with start and stop codonDepositorInsertnls-mCherry-Flag
UseCloning vectorAvailable SinceSept. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
ubc-nls-pcp-5xSunTag (SRv1)
Plasmid#185797Purposepcp-5xSunTag component for SunRISER SRv1DepositorInsertpcp-5xSunTag
TagsFactorXa site, HA, and NLSExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gMYOD1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106355PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of MYOD1 locusDepositorInsertMYOD1 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Crimson/P2A-NLS/HA-HumBeta (pSLIK2)
Plasmid#113857PurposeFor Doxycycline-inducible expression of Humanized Beta synaptase gene, with red fluorescent protein gene E2-Crimson-P2A-Humanized Beta synaptase geneDepositorInsertHumanized Beta
UseLentiviralTagsP2A/CrimsonMutation"humanized" Beta geneAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc AspCas12a
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-RFPnls-PQRv2-mCD8:GFP
Plasmid#73974PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in insect cells.DepositorInsertssfGFP
RFP
TagsmCD8 and nlsExpressionInsectPromoter20XUAS-HSAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-NLS-BirA-2A-mCherry_Ras
Plasmid#80065PurposeZic2a promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-Drosha (NLS-P426)
Plasmid#171538PurposeEncodes mutant human Drosha proteinDepositorInsertDROSHA (DROSHA Human)
ExpressionMammalianMutationan SV40 NLS sequence (PKKKRKVGI) insertion into t…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-NLS-BirA-2A-mCherry_Ras
Plasmid#80061PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Sga-NLS(SV40) (KAC92)
Plasmid#134334PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sma-NLS(SV40) (KAC95)
Plasmid#134335PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sma with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sma
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only