We narrowed to 1,808 results for: mcherry expressing plasmid
-
Plasmid#129596PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody variant-mCherry (2E2-HA scFv-mCherry)
ExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKS011
Plasmid#65464PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) MBP (Maltose Binding Protein), Ntag, and mCherryDepositorInsertMBP-Ntag-mCherry
TagsFLAG and MBPExpressionBacterialPromoterpl-TetOAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKS012
Plasmid#65465PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) Ntag and mCherryDepositorInsertNtag-mCherry
UseSynthetic BiologyTagsFLAGExpressionBacterialPromoterpl-TetOAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCh-Cry2WT_NLS
Plasmid#221925PurposeExpression of SV40 nuclear localization signal (NLS) fused to optogenetic protein mCh-Cry2WTDepositorInsertSV40 NLS
UseLentiviralTagsmCherryExpressionMammalianMutationinsertion of SV40 NLSAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJR255
Plasmid#78549PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. CMV driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, CMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJR288
Plasmid#78550PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. Ef1a driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, EF1aAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4938
Plasmid#107527PurposeExpresses Fn crRNA and mCherry in mammalian cells.DepositorInsertsFn crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4561
Plasmid#107525PurposeExpresses Lb crRNA and mCherry in mammalian cells.DepositorInsertsLb crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3179
Plasmid#107528PurposeExpresses Mb crRNA and mCherry in mammalian cells.DepositorInsertsMb crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP618_αGCN4-KRAB-CO
Plasmid#211782PurposeSunTag counterpart binding domain, aGCN4, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertaGCN4-mCherry
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect mCherr…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pRN11
Plasmid#84455Purposeshuttle plasmid for sarA P1-mCherry expressionDepositorInsertmCherry
UseShuttle vector e.coli-s.aureus, expression of sgf…Available SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
Plasmid#198417PurposeExpresses both OsTIR1F74A and mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertOsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBLO1806_Cas9_2xNLS_human
Plasmid#74493PurposeHuman codon optimized plasmid to express Cas9 t2a mCherry w/2xNLS and a sgRNADepositorInsertCas9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDB5230
Plasmid#215496PurposeA pAde6 backbone integrating plasmid expressing Pil1-mCherry-SpAtg8(1-115) under the inducible promoter 41nmt1DepositorInsertPil1-mCherry-SpAtg8(1-115)
ExpressionYeastPromoterP41nmt1Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GA46
Plasmid#196614PurposePlasmid used for the C-terminal tagging of Atp3 with mCherry and the auxin-inducible degron in yeastDepositorInsertATP3::mCherry-AID(71-114)-NatMX (ATP3 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only