169,450 results
-
Viral Prep#154868-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA (#154868). In addition to the viral particles, you will also receive purified pAAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA plasmid DNA. Syn-driven, Flp-dependent hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHuman Synapsin-1TagsmCherry (Flp-dependent)Available SinceAug. 19, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLJM1-EGFP
Plasmid#19319Purpose3rd gen lentiviral vector for EGFP fusion; PGK driven puromycinDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCBL101-RUBY
Plasmid#199723PurposeExpresses betalain biosynthesis genes under CaMV 35S promoterDepositorInsert35S-RUBY
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-VP16-GWY/pAM
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-GAL4BD/pAM
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6c
Plasmid#207853PurposeMammalian expression of PE6c prime editorDepositorInsertPE6c
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only