We narrowed to 5,008 results for: AAT
-
Plasmid#177719PurposeER protein alpha-1-antitrypsin (WT) fused to an HA tag and the eleventh β-strand of GFPDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pATZ-HA-GFP11
Plasmid#177720PurposeER protein alpha-1-antitrypsin containing E342K mutation (ATZ mutant) fused to an HA tag and the eleventh β-strand of GFPDepositorInsertalpha-1-antitrypsin (SERPINA1 Human)
TagsGFP11 and HAExpressionBacterial and MammalianMutationE342K (ATZ mutant)Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (CTNNB1)
Plasmid#180193PurposeAAV vector carrying a guide RNA targeting the human CTNNB1 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSAH0016
Plasmid#79824PurposeDual selection plasmid with lac operator, selection for binding with spectinomycin, for non-binding with chloramphenicolDepositorInsertscat
aadA
PromoterAATTCAAAAAAATGCTTGACAATTAATCATCGGCTCGTATAATGTGTGG…Available SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Circular 100,50 (RAB7A)
Plasmid#170117PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 100,50 guide RNA
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (RAB7A)
Plasmid#170118PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRNegativex3-WPRE-bGHpA
Plasmid#194249PurposeExpresses 3 non-targeting miRNAsDepositorInsertmiRNegative
UseAAV and RNAiPromoterCAGAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWT029c
Plasmid#96858Purposeguanine-agRNA (GFP activation)DepositorInsertguanine-agRNA (GFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT029g
Plasmid#96860Purposeguanine-agRNA (GFP activation, 18 nt blocker with bulges)DepositorInsertguanine-agRNA (GFP activation, 18 nt blocker with bulges)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only