We narrowed to 5,091 results for: codon optimized
-
Plasmid#162297PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATGDepositorInsertN-terminal tag, MBP-[TEV cleavage site]
UseSynthetic BiologyTagsExpressionMutationcodon optimized for E. coliPromoterAvailable sinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0545
Plasmid#162296PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATGDepositorInsertN-terminal tag, HiBiT-MBP-[Factor Xa cleavage site]
UseSynthetic BiologyTagsExpressionMutationcodon optimized for E. coliPromoterAvailable sinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0544
Plasmid#162295PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATGDepositorInsertN-terminal tag, MBP-[Factor Xa cleavage site]
UseSynthetic BiologyTagsExpressionMutationcodon optimized for E. coliPromoterAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0543
Plasmid#162294PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATGDepositorInsertN-terminal tag, GST-[TEV cleavage site]
UseSynthetic BiologyTagsExpressionMutationcodon optimized for E. coliPromoterAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0542
Plasmid#162293PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATGDepositorInsertN-terminal tag, HiBiT-GST-[thrombin cleavage site]
UseSynthetic BiologyTagsExpressionMutationcodon optimized for E. coliPromoterAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0541
Plasmid#162292PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATGDepositorInsertN-terminal tag, GST-[thrombin cleavage site]
UseSynthetic BiologyTagsExpressionMutationcodon optimized for E. coliPromoterAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
PV246
Plasmid#132337PurposeCasE constitutive expression cassette for Zea maysDepositorInsertCasE
UseTagsExpressionPlantMutationCodon optimize for expression and stability in Ze…PromoterAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV248
Plasmid#132339PurposeCasD constitutive expression cassette for Zea maysDepositorInsertCasD
UseTagsExpressionPlantMutationCodon optimize for expression and stability in Ze…PromoterAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV244
Plasmid#132335PurposeCasB constitutive expression cassette for Zea maysDepositorInsertCasB
UseTagsExpressionPlantMutationCodon optimize for expression and stability in Ze…PromoterAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV245
Plasmid#132336PurposeCasC constitutive expression cassette for Zea maysDepositorInsertCasC
UseTagsExpressionPlantMutationCodon optimize for expression and stability in Ze…PromoterAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW ymVenus-T2A-mTurquoise2
Plasmid#118443PurposeProduces equimolar expression of yeast codon-optimized mVenus and mTq2DepositorInsertymVenus-T2A-mTurquoise2
UseTagsExpressionYeastMutationPromoterAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW yotagRFPT-T2A-mTurquoise2
Plasmid#118449PurposeProduces equimolar expression of yeast codon-optimized tagRFPT and mTq2DepositorInsertyotagRFPT-T2A-mTurquoise2
UseTagsExpressionYeastMutationPromoterAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNB2629
Plasmid#113394PurposeMET25p-MS2-RFP-CYC1 TTDepositorInsertMS2 bacteriophage coat protein
UseTagsred fluorescent protein (RFP), codon-optimized fo…ExpressionYeastMutationPromoterAvailable sinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrascomG12D
Plasmid#206844PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a G12D mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
UseTagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…PromoterAvailable sinceOct. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrascomQ61R
Plasmid#206845PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a Q61R mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
UseTagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…PromoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
PARP1 FL
Plasmid#169815PurposeExpresses codon optimised full length His tagged PARP1 in bacterial cellsDepositorInsertPoly[ADP-ribose] polymerase 1 (PARP1 Codon optimised, Synthetic, Human)
UseTagsMKHHHHHHMKQExpressionBacterialMutationValine 762 mutated to an alaninePromoterT7 promoterAvailable sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSR13
Plasmid#69155Purposeread-outloxN mCherry to GFP switch, with swsn-1 promoter, gene (partially cDNA) and UTR, for integration on on ttTi5605, Mos Chr IIDepositorInsertsUseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0, codon-optimzed index 1.…Promoterrps-27 and swsn-1Available sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionTagsExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsPromoterAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
miCBE
Plasmid#205413PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with APOBEC3A and UGI driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6__RNA*_pCAG_bpNLS_APOBEC3A(W104A)_XTEN_OgeuIscB*(D61A)_NLS_2xUGI_bGHployA_pCMV_mCherry
UseTagsExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable sinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1137
Plasmid#84827PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1415
Plasmid#84828PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-tdTomato
Plasmid#62516PurposeExpresses tdTomato under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing proceduresDepositorInserttdTomato
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1955
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only