We narrowed to 1,717 results for: Tyr
-
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_EPHB4_Ephrin-lbd
Plasmid#109863PurposeProtein expression and purification of EPHB4_Ephrin-lbdDepositorInsertEPHB4_Ephrin-lbd (EPHB4 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL1 no-stop
Plasmid#123210PurposeGateway entry clone encoding human GABARAPL1 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL2 no-stop
Plasmid#123211PurposeGateway entry clone encoding human GABARAPL2 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-N-SH2+IA
Plasmid#111273Purposeexpress murine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site (Syk Mouse)
TagsHHHHHHENLYFQGExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSM4
Plasmid#101642PurposeEncodes the fluorescent protein KCyG4219 for constitutive expression in E. coli.DepositorInsertKCyG4219
Tags6XHisExpressionBacterialMutationC-terminal residues (221-223) deletion. Ser220Val…Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
csd2_121-308,Y197F/pET28b(+)
Plasmid#83299Purposecsd2, construct: 121-308, pET28b(+) NC-tag, mutation: Y197FDepositorInserthp1544
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-120, and changed Tyrosine 19…Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScalps_puro_mIL-2Rα ST
Plasmid#59919PurposeExpresses mouse interleukin-2 receptor alpha chain mutatedDepositorInsertinterleukin 2 receptor alpha (Il2ra Mouse)
UseLentiviralMutationchanged sequence of the intracellular (C-terminal…Available SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY1 mutant
Plasmid#17801DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EphrinB3-Flag
Plasmid#155012PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EphrinB3 from pcDNA3.1DepositorInsertEphrinB3 (EPHB3 Human)
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianPromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-v2 RsTAL At4CL
Plasmid#126524Purposeexpresses TAL (Rhodobacter sphaeroides) and 4CL (Arabidopsis thaliana paralog 1) for PYP chromophore biosynthesisDepositorInsertsTagsHisExpressionBacterialPromoterT7Available SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-mCherry
Plasmid#118272PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB3-Fc
Plasmid#200985PurposeMammalian expression plasmid for soluble EphB3 fused to IgG1 FcDepositorInsertEphB3 (EPHB3 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB3PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PM-RA-BlastR
Plasmid#211708PurposeLentiviral expression of a ddFP subunit (RA) fused with the lipid modification motif of lymphocyte-specific protein tyrosine kinase (Lck) for plasma membrane (PM) targetting (PM-RA)DepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cSrc
Plasmid#214233PurposeBacterial expression of the kinase domain of cSrc with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB2
Plasmid#200982PurposeMammalian expression plasmid for myc-tagged EphB2DepositorInsertEphB2 (EPHB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI-Myc3-HPS4
Plasmid#133931PurposeExpresses 3xMyc-HPS4 construct in mammalian cellsDepositorInsertHPS4 (HPS4 Human)
Tags3xMyc tagExpressionMammalianMutationGlutamic acid 229 to Glycine; Valine 552 to Methi…PromoterCMV I.E.Available SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-GFP
Plasmid#118270PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-muhCD4
Plasmid#162745PurposeNFAT-driven ZsGreen-1 reporter gene with mutated human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianMutationHuman CD4 gene with glutamine to tyrosine at posi…Available SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only