We narrowed to 7,818 results for: Lif
-
Plasmid#207086PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous MDC1 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human MDC1 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATM HRD
Plasmid#207085PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous ATM locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human ATM locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterNoneAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD3 HRD
Plasmid#207077PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD3 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD1 HRD
Plasmid#207076PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD1 locus.DepositorInsertHaloTag flanked by human SHLD1 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
hSyn-tractin
Plasmid#187649PurposeExpresses F-tractin (from ITPKA)-mNeongreen under control of human synapsin promoter.DepositorInsertF-tractin
UseAAVTagsmNeonGreenExpressionMammalianMutationPromoterSynapsinAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-HsTtyh1-TwinStrep-His
Plasmid#211332PurposeMammalian overexpression vector for C-terminally TwinStrep and His tagged human Ttyh1 (W417R)DepositorInsertTweety homology protein 1
UseLentiviralTagsTwinStrep, 10xHisExpressionMammalianMutationW417RPromoterCMVAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rif1-Halo HRD
Plasmid#207081PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterNoneAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169-Halo HRD
Plasmid#207083PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF169 locus.DepositorInsertHaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-AO-66-71-TVA950
Plasmid#217977PurposeAAV Transfer plasmid to express TVA950 in a Cre-dependent mannerDepositorInsertTVA950
UseAAVTagsExpressionMutationPromoternEFAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_R261A
Plasmid#202586PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the R261A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Arginine 261 to AlaninePromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MsACR1-pmCerulean3-N1
Plasmid#204958PurposeExpression of channelrhodopsin MsACR1 fused to mCerulean3 in mammalian cellsDepositorInsertMsACR1
UseTagsmCerulean3ExpressionMammalianMutationPromoterCMV (+enhancer)Available sinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shNC
Plasmid#206356PurposeAAV plasmid expressing non-targeting control shRNA in photoreceptorsDepositorInsertNon-targeting control shRNA
UseAAVTagsExpressionMutationPromoterhuman red opsinAvailable sinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-Txnip(C247S)
Plasmid#206353PurposeAAV plasmid expressing mutant TXNIPDepositorInsertTxnip (Txnip Mouse)
UseAAVTagsExpressionMutationC247SPromoterCMVAvailable sinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 AMSHLP 16-218
Plasmid#180609PurposeBacterial expression for AMSHLP MIT domain residues 16-218. Internal ID: WISP20-83DepositorInsertAMSHLP residues 16-218
UseTagsHIS-SUMOExpressionBacterialMutationResidues 16-218PromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPW3757 : CMVd3-ERmembrane-2xHaloTag-KKMP
Plasmid#185679PurposeLow-level transient expression of two tandem HaloTag proteins targeted to the ER membrane.DepositorInsertERmembrane-2xHaloTag-KKMP
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDG04095
Plasmid#196006PurposeNanobody Obs-Nano56 productionDepositorInsertH14-SUMO-Cys- ObsNano56-Cys
UseE.coli expressionTagsExpressionMutationPromoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only