We narrowed to 6,691 results for: cgas
-
Plasmid#161990PurposeExpresses two tandem repeats of Tapp1 PH domain that binds to PI(3,4)P2. Fused to eGFPDepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL046
Plasmid#198807PurposeIn vivo neuronal inhibition through histamine-gated chloride channel. Neurons expressing HisCl1 transgene are inhibited after addition of histamine.DepositorInsert15xUAS::HisCl1-SL2-GFP::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJR014
Plasmid#198813PurposeNatural light-gated anion channels. In vivo inhibition of neurons using blue light.DepositorInsert15xUAS::GtACR2::SL2::GFP::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
INPP5D-eGFP WT
Plasmid#161998PurposeMammalian expression vector, containing a GFP tagged version of INPP5DDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHW449
Plasmid#198805PurposeDirect light-gated cation channel from Chlamydomonas reinhardtii that allows neuron deploarization through brief pulses of blue light.DepositorInsert15xUAS::hChR2(H134R)-YFP::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102798PurposeRetrovirus for delivery of one sgRNA (self-targeting) - GFP-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-Col1a1/GFP4_Seq1.2
Plasmid#201403PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mMyh9 - 1
Plasmid#198491Purposelentiviral stable expression of mMyh9 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (CTNNB1)
Plasmid#180193PurposeAAV vector carrying a guide RNA targeting the human CTNNB1 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEBB HA CCDC22
Plasmid#74903PurposeExpress CCDC22 in mammalian cellsDepositorAvailable SinceJune 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
INPP5D-eGFP D673G mutant
Plasmid#161999PurposeMammalian expression vector, containing a GFP tagged phosphatase dead version of INPP5D (D673G)DepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHW581
Plasmid#198818PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity. Based on GCaMP7, improved SNR, fast kineticsDepositorInsert15xUAS::GCaMP7f-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only