We narrowed to 4,529 results for: GCA
-
-
-
-
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
SGK1 gRNA (BRDN0001146486)
Plasmid#77459Purpose3rd generation lentiviral gRNA plasmid targeting human SGK1DepositorInsertSGK1 (SGK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationN/APromoterhuman U6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-30kb-DSF
Plasmid#227483Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-30kb-DSF
Plasmid#227484Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-35kb-DSF
Plasmid#227490Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-66kb-DSF
Plasmid#227497Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 66kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-1.9kb-USF
Plasmid#227476Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 1.9kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-PrPro
Plasmid#227454Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only