We narrowed to 1,615 results for: Tef;
-
Plasmid#200883PurposeBacterial expression of N-terminal HiBIT-tagged human WDR5 proteinDepositorAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pGTVL2-BIRC2-BIR3
Plasmid#196367Purposeprotein expression of the GST-tagged BIR3 domainDepositorInsertBIRC2 BIR3 domain
TagsHis6-GST-TEVExpressionBacterialMutationcontains only S260-Y352PromoterT7Available SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[R272A,K276A, R280A,K284A]
Plasmid#188599PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler (Nbr Fly)
TagsFLAG-MycExpressionInsectMutationR272A [CGG=> GCG], K276A [AAG=>GCG], R280A …Available SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
TagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_2_dCas9_VP64_sgRNA
Plasmid#163707PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domainDepositorInsertsdCas9
VP64+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_WT USP7
Plasmid#131242PurposeMammalian expression of N-terminally Myc-tagged USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianPromoterCMV enhancer + CMV promoterAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
FRT_htr2c(c)-GFP
Plasmid#79677Purposeserotonin receptor minigene with consensus splice sites that expresses the full length serotonin receptor with a C-terminal EGFPDepositorInsertserotonin receptor 2C (HTR2C Human)
TagsEGFP in FrameExpressionMammalianMutationsplice site of exon Vb in consensusPromoterCMVAvailable SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human USP7-3X FLAG
Plasmid#225334PurposeLentiviral expression of human USP7 with 3x FLAG tag in mammalian cellsDepositorAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Linear Tau 0N4R 3X Flag tag
Plasmid#194171PurposeInsert contains linear tau 0N4R with a 3X Flag tag. Expresses linear protein tau 0N4R with a 3X Flag tag for Immunoprecipitation.DepositorInsertMicrotubule-Associated Protein Tau 0N4R
Tags3X FlagExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV14_NHP2L1(15.5kD)
Plasmid#73065Purposeexpression clone for human NHP2L1 (15.5kD) with C-terminal 3xFLAG-tagDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human USP7_H456A-3X FLAG
Plasmid#225335PurposeLentiviral expression of human mutant USP7 with 3x FLAG tag in mammalian cellsDepositorInsertUSP7 (USP7 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationH456APromoterEF1aAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-MBP human SPOP (aa 28-337)
Plasmid#52294Purposebacterial expression of human SPOP (aa 28-337) fused to His-MBPDepositorAvailable SinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMH-SFB-USP7
Plasmid#99393PurposeMammalian expression construct for S protein-Flag-Streptavidin binding peptide (SFB)-tagged USP7DepositorInsertUSP7 (USP7 Human)
TagsSFB (S protein-FLAG-Streptavidin binding peptide)ExpressionMammalianAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc-ns
Plasmid#226719PurposePlasmid enabling yeast-mediated expression of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
TagsHA tagExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg
Plasmid#73073Purposehuman E2F7 minigene (exons 11,12,13/introns cassette)DepositorInsertE2F7 (E2F7 Human)
ExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterCMVAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-EXO1b D173A
Plasmid#68269PurposeBacterial expression of human EXO1 D173A (catalytically-dead) mutantDepositorInsertEXO1 (EXO1 Human)
TagsMxe intein/chitin binding domainExpressionBacterialMutationcatalytically-dead D173A. Please see depositor co…PromoterT7Available SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-ATI_QconCAT_1
Plasmid#163957PurposeExression of ATI QconCAT protein in E. coli expression strains (BL21). Encodes a concatemer of tryptic peptides from wheat amylase/trypsin inhibitors. Used as standard for LC-MS-based quantification.DepositorInsertATI QconCAT
Tagspolyhistidine tagExpressionBacterialPromoterT7 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
Tags3X flag tagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only