We narrowed to 5,041 results for: U6...
-
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA4
Plasmid#89722PurposeKnockout IRF8 in human cellsDepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA3
Plasmid#89721PurposeKnockout IRF8 in human cellsDepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-mcherry)
Plasmid#217306PurposesgRNA mcherry + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-mcherry
UseCRISPRPromoterU6, Ef1alphaAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-BFP)
Plasmid#217305PurposesgRNA BFP + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-BFP
UseCRISPR and Synthetic BiologyPromoterU6, Ef1alphaAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-US-ECasE
Plasmid#83961PurposePiggyac transposon containing tamoxifen inducible Cas9 and a gRNA cassette.DepositorInsertERT2-spCas9-ERT2
ExpressionMammalianMutationplease see depositor comments belowPromoterU6 (gRNA), EF1a (ERT2-Cas9-ERT2)Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
plenti guide Thy1.1
Plasmid#128063PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and Thy1.1 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_gRNA_S.pyogenes_scaffold_BB
Plasmid#226429PurposePiggyBac transposon vector backbone for cloning of sgRNA compatible with S.pyogenes dCas9 enzyme. BbsI Golden Gate site upstream of the scaffold for protospacer insertion. Puromycin selection marker.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcU6.3_gRNA_c1
Plasmid#221381PurposeChicken-specific U6 sgRNA expression mini-vector with 10x capture sequence 1DepositorTypeEmpty backboneUseCRISPRPromoterG. gallus U6.3Available SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA A
Plasmid#127904PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Ubf gRNA
Plasmid#127902PurposeWT Cas9 Vector targeting the 3' end of the mouse Ubf geneDepositorInsertgRNA for Mouse 3' Ubf
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only