We narrowed to 4,471 results for: ara-2
-
Plasmid#89465PurposeDSG-2 tension sensor, using TSmod inserted in human DSG-2DepositorInsertdesmoglein-2 (DSG2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#2
Plasmid#107727PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorInsertMAPRE1 gRNA #1 (targets Exon 1) (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUS LC 4S->A#2
Plasmid#226604Purpose4 serines to alanine at residue positions 70, 84, 89, 95DepositorInsertFUS LC 4S->A#2 (FUS Human)
UseTags6HisExpressionBacterialMutation4 serines to alanine in sequence position subset …PromoterT7Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgINTS12 guide 2
Plasmid#193607PurposeINTS12 knockoutDepositorInsertsgINTS12 guide 2 (INTS12 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#2
Plasmid#171519Purposedeletion of a genomic locus in Yap1 geneDepositorInsertYap1 (Yap1 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (EGFP) shPnky-2
Plasmid#79142PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of CreDepositorInsertshPnky-2 (Gm30731 Mouse)
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterU6 for the shRNA and CMV for EGFPAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2
Plasmid#164435PurposeEncodes SARS-CoV-2 Spike Protein for pseudovirus productionDepositorInsertSARS-CoV-2 Spike (S )
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDM-SARS-CoV-2
Plasmid#164433PurposeEncodes SARS-CoV-2 Spike Protein for pseudovirus productionDepositorInsertSARS-CoV-2 Spike (S )
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSMARCA4 guide 2
Plasmid#193605PurposeSMARCA4 knockoutDepositorInsertsgSMARCA4 guide 2 (SMARCA4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PL-CRISPR.EFS.tRFP-gIfngr1-2
Plasmid#166480PurposeExpresses spCas9, tRFP and a gRNA targeting mouse Ifngr1DepositorInsertgRNA for mouse Ifngr1 (Ifngr1 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 2 DO
Plasmid#172722PurposeEncodes a sfGFP dropout expression cassette in place of Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseTags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV Retrograde)
Viral Prep#83899-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsNoneAvailable sinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-2-mTagBFP2(11x7)
Plasmid#172066PurposeProtein trap plasmid for inserting mTagBFP2(11x7) into a phase 2 coding intronDepositorInsertmTagBFP2(11x7)
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGST2-TSG101 (2-145)
Plasmid#184810PurposeBacterial expression of TSG101 UEV domain (aa 2-145)DepositorInsertTSG101 (TSG101 Human)
UseTagsGSTExpressionBacterialMutationaa 2-145 onlyPromotertacAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG018 (AVAST type 2)
Plasmid#157896PurposeExpresses the AVAST type 2 defense systemDepositorInsertAVAST type 2 (STAND ATPase with uncharacterized helical N-terminal domain)
UseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-His-hAR-2
Plasmid#89091Purposebaculovirus transfer vector for histidine-tagged full-length human androgen receptor, starts Met-Ala-His6-Met-hARDepositorInserthAR (AR Human)
UseTagsHisExpressionMammalianMutationPromoterAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only