We narrowed to 2,545 results for: crispr system
-
Plasmid#82393PurposesgRNA targeting YFP +172 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas52
Plasmid#82392PurposesgRNA targeting YFP +52 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPP300-T2A-GFP-IRES-Neo
Plasmid#102887PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-P300core activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-P300-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC0_6_sgRNA
Plasmid#163717PurposePlasmid encoding a placeholder sequence as a Type 234 part to be used in the Dueber YTK system (MoClo kit)DepositorInsertsgRNA expression cassette
UseSynthetic Biology; Moclo vector level 0 (type 234)Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-AtAFB2-mCherry
Plasmid#129716PurposeAAVS1 safe harbor targeting vector expressing AtAFB2-mCherryDepositorInsertAFB2 (AFB2 Mustard Weed)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsmCherryExpressionMammalianMutationcodon optimizedPromoterEF1aAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3
Plasmid#87906PurposesgRNA targeting GFPDepositorInsertsgGFP1, sgGFP2, sgGFP3
ExpressionMammalianPromoterH1, U6, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP339 pGK-dCas9-SunTag
Plasmid#100943PurposedCas9 vector with SunTagx10, driven by pGK, with 3xHA tag, Puro driven by EF1aDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHAExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-B-Seipin-miniIAA7-mEGFP
Plasmid#129719PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-mEGFP tagged SeipinDepositorInsertSeipin (BSCL2 Human)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsminiIAA7-mEGFPExpressionMammalianMutationsilent mutationsPromoterEF1aAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-AtAFB2-mCherry-weak NLS
Plasmid#129717PurposeAAVS1 safe harbor targeting vector expressing AtAFB2-mCherry-weak NLSDepositorInsertAFB2 (AFB2 Mustard Weed)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsmCherry-weak NLSExpressionMammalianMutationcodon optimizedPromoterEF1aAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
gfap-EGFP donor
Plasmid#65564PurposeIntron targeting-mediated EGFP knockin at the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-B-AtAFB2-mCherry
Plasmid#129718PurposeAAVS1 safe harbor targeting vector with blasticidin resistance gene expressing AtAFB2-mCherryDepositorInsertAFB2 (AFB2 Mustard Weed)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsmCherryExpressionMammalianMutationcodon optimizedPromoterEF1aAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-Seipin-miniIAA7-3XFlag
Plasmid#129722PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-3XFlag tagged SeipinDepositorInsertSeipin (BSCL2 Human)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsminiIAA7-3XFlagExpressionMammalianMutationsilent mutationsPromoterEF1aAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-Seipin-miniIAA7-mScarlet-I
Plasmid#129721PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-mScarlet-I tagged SeipinDepositorInsertSeipin (BSCL2 Human)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsminiIAA7-mScarlet-IExpressionMammalianMutationsilent mutationsPromoterEF1aAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP457 pGK-dCas9-Suntag-BFP
Plasmid#100957PurposeBPF version of LLP339, Puro is replaced by BFP driven by EF1a, dCas9 with SungTagx10 driven by pGK, with 3xHA tagDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHA and BFPExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-Seipin-miniIAA7-mCherry
Plasmid#129720PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-mCherry tagged SeipinDepositorInsertSeipin (BSCL2 Human)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsminiIAA7-mCherryExpressionMammalianMutationsilent mutationsPromoterEF1aAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_eZ3_Gal4VP64
Plasmid#169917PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch3 core with an additional EGF repeat, and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianMutationAdditional EGF repeat between the extracellular d…PromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only