We narrowed to 3,493 results for: cgas
-
Plasmid#20380DepositorAvailable SinceMay 1, 2009AvailabilityAcademic Institutions and Nonprofits only
-
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TER+-shLKB1-Hu
Plasmid#61243PurposeEntry clone encoding shRNA to human LKB1DepositorAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMP-G9A_1
Plasmid#36395DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTC394
Plasmid#91224Purposeprotoplast vector expressing gRNA24 targeting tomato ANT1 (control without TREX2 expression)DepositorInsertgRNA targeting tomato ANT1
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
plko.1/shMCT4 #474
Plasmid#99597PurposeKnockdown of MCT4 expressionDepositorInsertMCT4 (SLC16A3 Human)
UseLentiviralAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
p CIneo-RL-Let7-3xBulgeB-mut
Plasmid#115369PurposeExpression vector to produce humanized Renilla luciferase with three mutated (seed-sequence mutations) partially complementary binding sites for human let-7 miRNA in the 3'UTRDepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_INT
Plasmid#68436PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP1104
Plasmid#119248Purposeknockdown pqsC in P. aeruginosaDepositorInsertsgRNA pqsC (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Skil-gRNA2
Plasmid#180371Purposetargeting mouse Skil/SnoN geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
plko.1/shMCT4 477
Plasmid#99598PurposeKnockdown of MCT4 expressionDepositorInsertMCT4 (SLC16A3 Human)
UseLentiviralAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX PLCg1(C)-SH2
Plasmid#46469DepositorInsertPLCg1(C)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 656-766PromoterTacAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 Intergenic control guide 2
Plasmid#193585PurposesgRNA control; induces CAS9 cutting in an intergenic regionDepositorInsertsgRNA control
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only