We narrowed to 28,328 results for: STI
-
Plasmid#86060PurposeA mammalian expression plasmid encoding fibrocystin mimentic clone CFFΔC (CD8a luminal domain, fibrocystin transmembrane and ciliary targeting signal domains) with C-terminus Myc-tag.DepositorInsertFibrocystin (Pkhd1 Mouse)
TagsMycExpressionBacterialMutationcontains CD8a luminal and transmembrane domains a…PromoterCMVAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/C448Y with 5'UTR
Plasmid#89318Purposeexpression of C448Y spastin M1 and M87 in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Blast FAPwt
Plasmid#210643PurposeExpresses the FAP (Fibroblast Activation Protein) protein.DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RNF4wt-P2A-BLAST
Plasmid#208046PurposeEnables constitutive expression of N-terminal BirAopt-fused RNF4wt; to perform bioE3; selection with blasticidinDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-TET1-dCas9
Plasmid#235599PurposeExpresses Tet1CD-dCas9DepositorInsertTET1-dCas9 (TET1 Human, SpCas9 is from Streptococcus pyogenes)
UseCRISPR and LentiviralTags3xNLS and TET1 CDExpressionMammalianPromoterEF1aAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-tdTomato-P2A-BlasR (LRT2B)
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralMutationWTPromoterU6Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHPHS232
Plasmid#228356PurposeLanding pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locusDepositorInsertsmTagBFP2
Reverse tetracycline transactivator 3
neo
TagsBlasticidin S deaminase and iCasp9ExpressionMammalianPromoterTRE3GV and gene trapAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mARGAna (cassette 1, transient)
Plasmid#197588PurposeSecond-generation mammalian acoustic reporter gene derived from AnabaenaDepositorInsertmARGAna (cassette 1)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 mCherry-Rtn4HD
Plasmid#86685PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-CKS1
Plasmid#177013PurposeGenerate baculovirus for insect cell expression of CKS1 with N-terminal Polyhistidine-TEVDepositorInsertCKS1 (CKS1B Synthetic, Human)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-192-3p
Plasmid#103303PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-192-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-192-3p target (MIR192 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-192-5p
Plasmid#103304PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-192-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-192-5p target (MIR192 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX311-Cas9
Plasmid#118018PurposeConstitutive expression of Cas9DepositorInsertCas9
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVAX1-cGAS
Plasmid#196624PurposeExpress mouse cGAS protein in mammalian cells.DepositorAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-G-LbCas12a crRNA-BsaI cassette (MSP3495)
Plasmid#114068PurposeT7 promoter crRNA entry vector used for in vitro transcription of LbCas12a guidesDepositorInsertentry vector for LbCas12a crRNAs
UseIn vitro transcriptionAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB_Cdc42-TomKat-sensor-CAAX
Plasmid#172473PurposePiggybac vector for mammalian expression of TomKat (tdTomato-tdKatushka) FRET sensor for Cdc42 activity anchored to the membrane with the polybasic and CAAX motif from Kras.DepositorInserttdKatushka2-PBD(Pak1)-EVlinker-Cdc42-tdTomato-CAAX
UsePiggybac transposonTagspolybasic and CAAX motif from Kras, tdKatushka2, …ExpressionMammalianPromoterCAGAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-FLTID-GSQ-RBXN-P2A-BLAST
Plasmid#208041PurposeEnables constitutive expression of TurboID alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; selection with blasticidinDepositorInsertTurboID
UseLentiviralPromoterEFSAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-130b-3p
Plasmid#103217PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-130b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-130b-3p target (MIR130B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHIV-INK4A-zsGreen
Plasmid#110728PurposeMammalian Expression of p16INK4A IRES zsGreenDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only