We narrowed to 7,278 results for: cas9 plasmid
-
Plasmid#84040PurposeStaphylococcus aureus (SaCas9) conjugated with GFPDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-EGFPExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP2443
Plasmid#72252PurposeHuman expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2440
Plasmid#72250PurposeHuman expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, R1335Q, and T…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP977
Plasmid#65774PurposeHuman expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E mutation in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRExpressionMammalianPromoterCMV, U6, and hPGKAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbC-dsRED
Plasmid#84034PurposeContains Golden Gate cassette to express up to four gRNAs and dsREDDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only