We narrowed to 2,727 results for: pyogenes Cas9
-
Plasmid#121012PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9). Please see Supplemental Documents for annotated Genbank file.DepositorInsertCas9
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-SPn-VP64
Plasmid#48674PurposeMammalian SP-VP64 nuclease-null Cas9 activator expression, human optimizedDepositorInsertCas9-VP64, nuclease-null
UseCRISPRTagsNLS and VP64Mutationnuclease-nullPromoterCMVAvailable SinceDec. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
EE-SP!gIII
Plasmid#48667PurposeBacterial SP Cas9 targeting filamentous phage gene III at five protospacersDepositorInsertsCas9
anti-gIII tracrRNA
UseCRISPRPromoterproC and tracrRNA promoterAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSP2443
Plasmid#72252PurposeHuman expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2440
Plasmid#72250PurposeHuman expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, R1335Q, and T…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKI1.1R
Plasmid#85808PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter.DepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAG and NLSExpressionPlantPromoterAtRPS5AAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMJ922
Plasmid#78312PurposeExpression of His6-MBP-tagged Cas9-NLS-EGFP protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-EGFP-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-OC-IRES-BSD
Plasmid#53118PurposeTo create stable cell clones with high-level expression of Cas9 and OCT1DepositorInsertsUseLentiviralTagsIRES-BSD, NLS, and P2AExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRC319
Plasmid#61272PurposeAlso referred to as pΦRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA targeting the NDM-1 gene. Contains a ColE1 origin, kanamycin resistance cassette and f1 origin for packaging in M13 particles.DepositorInsertCas9, tracrRNA, crRNA
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
px458 EQR
Plasmid#101731PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationEQR (D1135E, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330 VRER
Plasmid#101729PurposeExpresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifsDepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E, and T1337R mutation…Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only