We narrowed to 42,127 results for: Eras
-
Plasmid#158527PurposeExpresses human KRAS P34R in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 2+linker3
Plasmid#176920Purposeexpress Granulin 2 with linker 3 in mammalian cellsDepositorInsertGranulin 2+linker3 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-1574/+120
Plasmid#35539DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI1A-3×FLAG
Plasmid#215509PurposeExpresses FLAG tagged human WIPI1A.DepositorInsertWD-repeat protein interacting with phosphoinositides 1A (WIPI1 Human)
UseRetroviralTags3×FLAGExpressionMammalianAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SV40P-Tet2 enhancer H1
Plasmid#63883PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet2DepositorInsertTet2 enhancer fragment H1
UseLuciferaseExpressionMammalianPromoterSV40Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Paragranulin+linker 1
Plasmid#176915Purposeexpress Paragranulin with linker 1 in mammalian cellsDepositorInsertParagranulin + linker 1 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only