We narrowed to 3,357 results for: phage
-
Plasmid#133799PurposeCMV and T7 promoter expression plasmid for human codon optimized Leu-AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized Leu-AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-Eriv-NLS(SV40) (KAC442)
Plasmid#133800PurposeCMV and T7 promoter expression plasmid for human codon optimized Eriv-AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized Eriv-AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTSlb-R756S
Plasmid#60730PurposeExpresses both fragments of T7 RNAP split at position 179. The N-terminal fragment is driven by PLac while the C-terminal fragment is driven by PBAD. C-terminal fragment has the point mutations R756SDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTSara-R756S
Plasmid#60725PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation R756S. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTSara-Q758C
Plasmid#60724PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation Q758C. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
C86m
Plasmid#120997PurposeMoClo golden gate assembly CD part (phage lysis protein; lethal to host when expressed). Please see Supplemental Documents for annotated Genbank file.DepositorInsertX174E
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C115m
Plasmid#121014PurposeMoClo golden gate assembly CD part for TP901 integrase (Integrase from lactococcal phage TP901). Please see Supplemental Documents for annotated Genbank file.DepositorInsertTP901 integrase
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6d
Plasmid#207854PurposeMammalian expression of PE6d prime editorDepositorInsertPE6d
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrt(T128N, V223Y, D200C)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6e
Plasmid#207855PurposeMammalian expression of PE6e prime editorDepositorInsertPE6e
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationCas9(H840A, K918A, K775R)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2Cre
Plasmid#82415PurposeLentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning siteDepositorInsertCre Recombinase
UseCRISPR, Cre/Lox, and LentiviralMutationMutated BsmBI cut sitePromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmaxRNaseHtrunc
Plasmid#207858PurposeMammalian expression of PEmaxDRNaseH prime editorDepositorInsertPEmaxDRNaseH
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrtAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET42b-BE3
Plasmid#87437PurposeExpresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCP-Rep-X-RT∆R
Plasmid#239384PurposeFor circular RNA-mediated inverse prime editor using MCP-Rep-X-M MLV-RT∆RNase H in HEK294T cellsDepositorInsertMCP, Rep-X, M-MLV-RT(∆RNase H)
UseCRISPRTagsBPNLSExpressionMammalianMutation∆RNase H in M-MLV RTPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET42b-HF-BE3
Plasmid#87438PurposeExpresses HF-BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HF-BE3
Plasmid#87439PurposeExpresses HF-BE3 with C-terminal NLS in mammalian cellsDepositorInsertHF-BE3 (Apobec1 Rat, Bacillus phage PBS2, Human)
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMC059-HisMS2_PLP_NucPhos_pac
Plasmid#155039PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Nucleocapsid Phosphoprotein geneDepositorInsertsMaturation Protein
Coat Protein Dimer
Nucleocapsid Phosphoprotein
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677)
Plasmid#160641PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.DepositorInsertERLexABDGal4AD / PhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only