We narrowed to 3,325 results for: phage
-
Plasmid#239384PurposeFor circular RNA-mediated inverse prime editor using MCP-Rep-X-M MLV-RT∆RNase H in HEK294T cellsDepositorInsertMCP, Rep-X, M-MLV-RT(∆RNase H)
UseCRISPRTagsBPNLSExpressionMammalianMutation∆RNase H in M-MLV RTPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET42b-BE3
Plasmid#87437PurposeExpresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET42b-HF-BE3
Plasmid#87438PurposeExpresses HF-BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HF-BE3
Plasmid#87439PurposeExpresses HF-BE3 with C-terminal NLS in mammalian cellsDepositorInsertHF-BE3 (Apobec1 Rat, Human, Bacillus phage PBS2)
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMC059-HisMS2_PLP_NucPhos_pac
Plasmid#155039PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Nucleocapsid Phosphoprotein geneDepositorInsertsMaturation Protein
Coat Protein Dimer
Nucleocapsid Phosphoprotein
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677)
Plasmid#160641PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.DepositorInsertERLexABDGal4AD / PhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-α-Synuclein-c_myc
Plasmid#225222PurposeYeast optimized human alpha synuclein fused with aga2 protein gene under gal1 promoter for the expression of alpha synuclein in yeast surface display.DepositorInsertsα-Synuclein
Aga2
TagsGS linker, HA Tag, and c-myc TagExpressionYeastPromoterGAL1Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 Register 1/3 Tnos:YFP:5'UTR (GB1507)
Plasmid#160583PurposePart 1/3 for assembly of site-specific recombination based Registers. Composed of the reversed sequences of the TNos terminator,YFP CDS and 5' UTR of 35S promoter (TNos:YFP:5'UTR)DepositorInsertYFP
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD 5'UTR:YFP:Tnos (GB1483)
Plasmid#160557PurposePart 3/3 for assembly of site-specific recombination based Registers. Composed of the 5'UTR sequence of 35S promoter, coding sequence of YFP and NOS terminator (5'UTR:YFP:TNos)DepositorInsert5'UTR:YFP:Tnos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 Assembly Register 3/3 Part - 5'UTR:Luc:Tnos (GB1500)
Plasmid#160581PurposePart 3/3 for assembly of site-specific recombination based Registers. Composed of the 5'UTR sequence of 35S promoter, coding sequence of Luc and NOS terminatorDepositorInsertLuc
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1(CTD)-NLS(SV40) (KAC438)
Plasmid#133796PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 (truncated C-terminal domain only) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1 (truncated C-terminal domain only)
TagsNLS(SV40)ExpressionMammalianMutationC-terminal domain onlyPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1(T114A/F115A)-NLS(SV40) (KAC688)
Plasmid#133798PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1(T114A/F115A) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1(T114A/F115A)
TagsNLS(SV40)ExpressionMammalianMutationT114A/F115APromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-mNeonGreen puro
Plasmid#193973Purposelentivector coding for mNeonGreen fused to a nanobody targeting the ALFA tag, puromycin resistanceDepositorInsertNbALFA-mNeonGreen
UseLentiviralTagsmNeonGreenExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-mNeonGreen hygro
Plasmid#193974Purposelentivector coding for mNeonGreen fused to a nanobody targeting the ALFA tag, hygromycin resistanceDepositorInsertNbALFA-mNeonGreen
UseLentiviralTagsmNeonGreenExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti NbALFA-miRFP680 hygro
Plasmid#193969Purposelentivector coding for miRFP680 fused to a nanobody targeting the ALFA tag, hygromycin resistanceDepositorInsertNbALFA-miRFP680
UseLentiviralTagsmiRFP680ExpressionMammalianPromoterEF1aAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only