We narrowed to 967 results for: Tcta
-
Plasmid#96861Purpose(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)DepositorInsert(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)
UseTagsExpressionMammalianMutationPromoterAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
UseTagsExpressionMammalianMutationPromoterAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
UseTagsExpressionMammalianMutationPromoterAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRL2 GAL1(TATA-C2)pr VYFP (EB#1577)
Plasmid#14851DepositorInsertGAL1 promoter TATA-C2 (GAL1 Budding Yeast)
UseTagsVYFPExpressionYeastMutationTATA-C2. TATA box mutated from TATATAAG to TCTATA…PromoterAvailable SinceMay 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJRL2 GAL1(TATA-C2)pr ECFP (EB#1578)
Plasmid#14852DepositorInsertGAL1 promoter TATA-C2 (GAL1 Budding Yeast)
UseTagsECFPExpressionYeastMutationTATA-C2. TATA box mutated from TATATAAG to TCTATA…PromoterAvailable SinceMay 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+-Tornado-nLuc
Plasmid#212611PurposeFor expression of a circular nLuc mRNA. To express your gene of interest clone into the BsiWI, SacII sites and add the GCCATGTcTATGTGG 5' of the SacII site.DepositorInsertTornado-CVB3-nLuc
UseLuciferaseTagsExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: TACGTTCTCTATCACTGATPromoterAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJYS2_crtYf
Plasmid#85544PurposeConstitutive transcription of crRNA of crtYf, Spectinomycin resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…TagsExpressionBacterialMutationPromoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-TRE3G-TdTomato
Plasmid#192658PurposeA plasmid encoding TRE3G sgRNA and TRE3G-promoter-TdTomatoDepositorInsertTdTomato
UseTagsExpressionMammalianMutationPromoterU6, TRE3GAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRTagsExpressionMammalianMutationnot applicablePromoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJYS2cm_crtYf
Plasmid#85543PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…TagsExpressionBacterialMutationPromoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTarget12f1
Plasmid#171183PurposeConstitutive expression of sgRNA without donor DNADepositorInsertsgRNA scaffold in the CRISPR/Cas12f1 system
UseCRISPRTagsExpressionBacterialMutationPromoterJ23119(SpeI) promoterAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1870-1 pHR: U6-SpsgTRE3G CMV-mCherry
Plasmid#84248PurposeExpresses Sp sgTRE3G gRNA with a mCherry fluorescent markerDepositorInsertSp sgTRE3G
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
UseTagsExpressionMutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …PromoterAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
UseTagsExpressionMutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…PromoterAvailable SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC603
Plasmid#62317PurposesgRNA with 2x PP7 for yeast cellsDepositorInsertsgRNA + 2x PP7 RNA binding module
UseTagsExpressionYeastMutationPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-HDAC1-shRNA2
Plasmid#90241PurposeLentivirus for expression of shRNA2 against human HDAC1 (Dox-inducible)DepositorAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC545
Plasmid#62313PurposesgRNA with 1x MS2 for yeast cellsDepositorInsertsgRNA + 1x MS2 binding module
UseTagsExpressionYeastMutationPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AksgRNA
Plasmid#121955PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAkCas12b single chimeric gRNA
UseTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only