We narrowed to 20,725 results for: Kin
-
Plasmid#108488Purposeexpression of Flag-AuroraB kinase death (K106R)DepositorInsertAuroraB (AURKB Human)
TagsFlagExpressionMammalianMutationKinase death K106APromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB
Plasmid#183676PurposeRecombinant Salmonella Typhimurium SopBDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium, Budding Yeast)
TagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialPromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSK_HUMAN_D0
Plasmid#79683PurposeThis plasmid encodes the kinase domain of CSK. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pCDNA3.1-nAChr-beta3
Plasmid#48811PurposeThis report is the first to directly measure nAChR subunit stoichiometry using FRET and plasma membrane localization of α6- and β3-containing receptors using TIRF.DepositorAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HtrA2-FLAG S142D
Plasmid#15939DepositorAvailable SinceNov. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
-
pJW1927
Plasmid#163093PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet-I^SEC (Lox511I)^TEV::AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAN19-3xFLAG-TIR1-NOSt
Plasmid#108545PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with 3xFLAG and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTags3xFLAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLAP-MIS12-KARD
Plasmid#114057Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
SLC30A10-delta105-107
Plasmid#65205PurposeConstitutive expression of SLC30A10 delta 105-107 in mammalian cellsDepositorInsertSLC30A10 (SLC30A10 Human)
TagsFlagExpressionMammalianMutationdelta 105-107 amino acidsPromoterCMVAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TO-HA-Δ37 PPM1H-mito
Plasmid#208375PurposeLentiviral expression of human Δ37-PPM1H with C-terminal mito signalDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221112PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterSTE3Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TO-Δ37 PPM1H -PACT-HA
Plasmid#208373PurposeLentiviral expression of human Δ37-PPM1H with C-terminal HA tagDepositorAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TO-Δ37 PPM1H-TMEM115-HA
Plasmid#208374PurposeLentiviral expression of human Δ37-PPM1H with C-terminal TMEM115-HADepositorAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat DJ-1 shRNA
Plasmid#222870PurposeExpresses mTagBFP2 along with an shRNA against rat DJ-1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1H S124A/S211A
Plasmid#208370PurposeMammalian expression of HA-tagged human PPM1H S124A/S211ADepositorAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 myc-Rab10-mito
Plasmid#208367PurposeMammalian expression of myc-tagged human Rab10 with C-terminal mito signalDepositorAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only