We narrowed to 15,401 results for: CCH
-
Plasmid#113875Purposeexpression of double Cas9 programming sgRNA11 targetting STL1DepositorInsertdoble sgRNA11-STL1
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB8709
Plasmid#175224PurposeXenopus oocyte expression vector containing YOL092W. Contains T7 RNA polymerase binding site, and adds polyA tail to YOL092W. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYOL092W (CEN.PK strain)
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8709
Plasmid#175224PurposeXenopus oocyte expression vector containing YOL092W. Contains T7 RNA polymerase binding site, and adds polyA tail to YOL092W. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYOL092W (CEN.PK strain)
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
TagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
TagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-tdTomato-FNF-TK
Plasmid#134320PurposeB6J Lrig1-T2A-tdTomato allele targeting vector, low copy numberDepositorAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-tdTomato-FNF-TK
Plasmid#134320PurposeB6J Lrig1-T2A-tdTomato allele targeting vector, low copy numberDepositorAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
TagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP129 [pRS406-YBR139Wp-YBR139W(S219A)-GFP-ADH1t]
Plasmid#106466PurposeExpresses Atg42/Ybr139w(S219A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP131 [pRS406-YBR139Wp-YBR139W(H474A)-GFP-ADH1t]
Plasmid#106467PurposeExpresses Atg42/Ybr139w(H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Histidine 474 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP133 [pRS406-YBR139Wp-YBR139W(D415A)-GFP-ADH1t]
Plasmid#106468PurposeExpresses Atg42/Ybr139w(D415A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(D415A)
TagsGFPExpressionBacterial and YeastMutationChanged Aspartate 415 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
TagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP129 [pRS406-YBR139Wp-YBR139W(S219A)-GFP-ADH1t]
Plasmid#106466PurposeExpresses Atg42/Ybr139w(S219A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP131 [pRS406-YBR139Wp-YBR139W(H474A)-GFP-ADH1t]
Plasmid#106467PurposeExpresses Atg42/Ybr139w(H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Histidine 474 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP133 [pRS406-YBR139Wp-YBR139W(D415A)-GFP-ADH1t]
Plasmid#106468PurposeExpresses Atg42/Ybr139w(D415A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(D415A)
TagsGFPExpressionBacterial and YeastMutationChanged Aspartate 415 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only