We narrowed to 5,240 results for: codon optimized
-
Viral Prep#87306-AAV1PurposeReady-to-use AAV1 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only
-
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV5)
Viral Prep#87306-AAV5PurposeReady-to-use AAV5 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV2)
Viral Prep#87306-AAV2PurposeReady-to-use AAV2 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A12.T)
Viral Prep#157970-AAV.A12.TPurposeReady-to-use AAV44.9(E531D) in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A01.T)
Viral Prep#157970-AAV.A01.TPurposeReady-to-use AAV2 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A09.T)
Viral Prep#157970-AAV.A09.TPurposeReady-to-use AAV6 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A11.T)
Viral Prep#157970-AAV.A11.TPurposeReady-to-use AAV44.9 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A07.T)
Viral Prep#157970-AAV.A07.TPurposeReady-to-use AAV2 (trpYF) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A06.T)
Viral Prep#157970-AAV.A06.TPurposeReady-to-use AAV2 (trpYF) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A04.T)
Viral Prep#157970-AAV.A04.TPurposeReady-to-use AAV2 (Y444F) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A05.T)
Viral Prep#157970-AAV.A05.TPurposeReady-to-use AAV2 (Y444F) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A03.T)
Viral Prep#157970-AAV.A03.TPurposeReady-to-use AAV2 in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A02.T)
Viral Prep#157970-AAV.A02.TPurposeReady-to-use AAV2 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only