We narrowed to 25,285 results for: crispr
-
Plasmid#91016PurposeModule A, Promoter: 35S, Gene: Csy4-P2A-AtCas9_D10A nickase, Terminator: HSPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCsy4-P2A-AtCas9_D10A nickase
UseCRISPRMutationD10APromoter35SAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-3XGFPnls
Plasmid#75385PurposePCP-3XGFPnlsDepositorInsertPCP
UseLentiviralTags3XsfGFPExpressionMammalianPromoterEFSAvailable sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eGFPbait-E2A-KalTA4-pA donor vector
Plasmid#61069Purposefor CRISPR/Cas9 mediated insertion of E2A-KalTA4; to be used in combination with a eGFP specific sgRNA (e.g. Plasmid 61051)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertseGFPbait
KalTA4
UseZebrafish expressionTagsE2AAvailable sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR4-Cas9-V5
Plasmid#87905PurposeCloning vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-V5
UseCloning vectorTagsV5MutationHuman codon optimizedPromoterV5Available sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTarget_CAST
Plasmid#127926PurposeTarget plasmid containing PSP1DepositorInsertPSP1 target (GGTT PAM)
Available sinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE-EFS-MCP-3XBFPnls
Plasmid#75384PurposeMCP-3XBFPnlsDepositorInsertMCP
UseLentiviralTags3XBFPExpressionMammalianPromoterEFSAvailable sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-AAVS1-5-1kbdonor
Plasmid#234735PurposePseCAST crRNA targeting AAVS1-5, with 1 kb donor transposonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1-5 crRNA
ExpressionMammalianAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
L4440_BioBrick-sgRNA
Plasmid#177783PurposeOverexpression of sgRNAs in E. coli HT115, sgRNA overexpression scaffold; for ingestion by C. elegansDepositorTypeEmpty backboneExpressionBacterialAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PET-B-Sniper SpCas9-NLS-6xHis
Plasmid#207377PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertB-Sniper SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationF539S, M763I, K890N, amino acids 1005-1013 replac…PromoterT7Available sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3d
Plasmid#66200Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3dAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-tetON-dxCas9(3.7)-VPR-EF1a-TagRFP-2A-tet3G
Plasmid#167937PurposeInducible CRISPRa expressionDepositorInsertdxCas9(3.7)-VPR
UseLentiviralPromotertetONAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
-
HypaCas9
Plasmid#138557PurposeExpresses human codon-optimized hyper-accurate SpCas9 and blasticidin resistance: EFS promoter-HypaCas9-NLS-FLAG-P2A-BSDDepositorInsertHypaCas9
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationN692A, M694A, Q695A, H698APromoterEFSAvailable sinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-hROSA26-1-1kbdonor
Plasmid#234736PurposePseCAST crRNA targeting hROSA26-1, with 1 kb donor transposonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthROSA26-1 crRNA
ExpressionMammalianAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only