We narrowed to 110 results for: NEUROG2;
-
Plasmid#215033PurposeMammalian expression of human TWIST1 (with NEUROG2 loop)DepositorInserttwist family bHLH transcription factor 1 (TWIST1 Human)
TagsV5ExpressionMammalianMutationTWIST1 bHLH loop (aa137-141, TLPSD) replaced withā¦PromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_V5-TWIST1_NEUROG2ins
Plasmid#215037PurposeMammalian expression of human TWIST1 (with insertion from NEUROG2)DepositorInserttwist family bHLH transcription factor 1 (TWIST1 Human)
TagsV5ExpressionMammalianMutationTWIST1 bHLH loop with insertion from NEUROG2 bHLHā¦PromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNeurog2-Luciferase reporter
Plasmid#64126PurposePhotoactivatable transcription system. Luciferase reporter under the control of the Neurog2 promoter.DepositorInsertNeurog2 promoter
UseLuciferaseTagsluciferaseExpressionMammalianPromoterNeurog2Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_pNeurog2-Luciferase reporter
Plasmid#64160PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target pNeurog2-Luciferase reporter.DepositorInsertsgRNA1 for pNeurog2-Luciferase reporter
UseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
P932_CLYBL-CBX3-Cbh-Zeo-TetO-NEUROG2
Plasmid#202762PurposeEncodes one forebrain neuron specific transcription factor under the control of a TetOn promoter at the CLYBL safe harborDepositorAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (gRNA: Neurog2-2)
Plasmid#159660PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Neurog2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (gRNA: Neurog2-3)
Plasmid#159661PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Neurog2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (gRNA: Neurog2-1)
Plasmid#159659PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Neurog2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2)
Plasmid#171100PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Neurog2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
LITE2.0 EF1a_TALE(Neurog2)-GS-CIB1(NLS*,ā318-334)_WPRE_hGHpA
Plasmid#47458PurposeLITE2.0 TALE-CIB1. Changes from LITE1.0: glycine-serine linker, mutated endogenous NLS, aa318-334 deletion. This particular TALE targeted to Neurog2. EF1-alpha promoter for ubiquitous mammalian exp.DepositorInsertTALE (Neurog2)-GS-CIB1(NLS*,ā318-334)
TagsHAExpressionMammalianPromoterEF1-alphaAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
CBIG-Ngn2
Plasmid#48708Purposebicistronic expression of Ngn2 and EGFPDepositorAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Ngn2:2A:Ascl1
Plasmid#127289Purposeall-in-one inducible LV expression construct for Ngn2:2A:Ascl1 (aka UNA; for direct neuronal conversion)DepositorUseLentiviralTagsNgn2 and Ascl1 linked via 2AExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSC-NGN2-IRES-ISL1-T2A-LHX3
Plasmid#221814PurposeLentiviral vector expressing human NEUROG2, ISL1 and LHX3 for inducing pluripotent stem cells into cholinergic motor neurons.DepositorUseLentiviralExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-oNGN2
Plasmid#198397PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression. oNGN2 is a Phospho-mutant which avoids inhibition by cdk kinase, NGN2 optimization aided by IDT tool.InsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationS24A, S193A, S207A, S209A, S219A, S232A, S239A, Sā¦PromoterCAG, EF1a, and TRE3GAvailable SinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMin-DHS-4D-GFP
Plasmid#159653PurposeReporter plasmid for the DHS-4D Otx2 enhancer element.DepositorInsertDHS-4D
ExpressionMammalianPromoterTATAAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only