30,808 results
-
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
ExpressionBacterial and YeastPromoterAgTEF1Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEXndoS
Plasmid#44655DepositorAvailable SinceMay 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a-CohIII-CBM-HIS-ybbR
Plasmid#60866PurposeCharacteristic fingerprint molecule fused to cohesin type III domain to perform single molecule force spectroscopy experiments; covalently immobilized via introduced ybbR tagDepositorInsertsCohIII
CBM
Tags6xHIS, HRV 3C, and ybbRExpressionBacterialMutationCysteine 63 to Serine in CBM modulePromoterT7Available SinceNov. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAJM.884
Plasmid#108536PurposeAcuRAM + PAcu-YFP Reporter. Acr sensor for use in non-Marionette strain.DepositorInsertAcuRAM + PAcu-YFP
ExpressionBacterialMutationAcuR: E80K R154H L202MAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRAV16
Plasmid#123389Purposeconstruction of TCRDepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRAV13-1
Plasmid#123386Purposeconstruction of TCRDepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSAR3.1t
Plasmid#210254PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneriDepositorInsertsmCerulean
superfolder GFP
TagsssraExpressionBacterialPromoteripaH7.8p and rpsMAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-AQNAT
Plasmid#198211PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing a non-permissible AQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_AQNAT
Tags6x His Tag and AQNAT mutated (non-permissible) gl…ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOOR
Plasmid#198212PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing the minimum optimal O-linked recognition site (MOOR) followed by a 6x-His tagDepositorInsertsfGFP_MOOR
Tags6x His Tag and MOOR glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Yellow Cameleon-Nano15/pBig
Plasmid#51962PurposeExpression of Yellow Cameleon-Nano15, an ultrasensitive Ca2+ indicator with Kd = 15 nM, in DictyosteliumDepositorInsertYellow Cameleon-Nano15
ExpressionBacterialAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
XXBLM (XXBLMA-c075)
Plasmid#98223PurposeVector for periplasmic expression of Lama antibodies with PelA leader and C-terminal His6 tagDepositorAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET15b-Opt13
Plasmid#61698PurposeExpresses PTDH mutant Opt13DepositorInsertOpt13
Tags6xHisExpressionBacterialPromoterT7Available SinceMarch 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLG016 (ApeA)
Plasmid#157894PurposeExpresses the ApeA defense systemDepositorInsertApeA (putative HEPN RNase)
ExpressionBacterialAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
His6-TEV-Venus-pBluescript
Plasmid#166756PurposeFor purification of Venus fluorophoreDepositorInsertVenus
Tags6x Histidine tag, and TEV protease siteExpressionBacterialPromoterT7Available SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-NLS-M-MLV-RT
Plasmid#181804PurposepET28a-NLS-M-MLV RTDepositorInsertNLS-M-MLV-RT
ExpressionBacterialAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBL6
Plasmid#50549PurposeExpresses mCherry under the PLtetO-1 promoterDepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRSET-GCaMP6f
Plasmid#67564Purposebacterial expression of a fluorescent calcium reporterDepositorInsertGCaMP6f
TagsHIS-tagExpressionBacterialAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pM9-BetaGal-8C
Plasmid#172489PurposePlasmid encoding E. coli BetaGalactosidase with an N-terminal M9 nuclear localization sequenceDepositorInsertM9-BetaGal-8C
Tags6xHis and M9 nuclear localization sequence (from …ExpressionBacterialMutationBetaGal has two cysteine mutations (C77A, C1022S)…PromoterT7Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
KRASB
Plasmid#25153PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceAug. 6, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only