1,779 results
-
Plasmid#199691PurposePnmr-1 FLPe unc-54 3' UTR C.elegans AVA/E/D premotor IN and others expression of FLPeDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pJH2829
Plasmid#199693PurposePcex-1 tomm-20::miniSOG UrSL mCherry unc-54 3' UTR C.elegans RIM neuron expression of miniSOG RFPDepositorInsertminiSOG
TagsRFPExpressionWormPromoterPcex-1Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS110
Plasmid#215674PurposeSplit hygromycinR landing pad insertion plasmid for ChrIIIDepositorInsert5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
UseCRISPR and Cre/LoxExpressionWormMutation3' ∆HYGR is promoterless and encodes aa60-341Available SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH64 - [AFDp | gfp | tbb-2 UTR]
Plasmid#200338Purposegfp BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00001535, gcy-8Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH50 - [PVQp | gfp | tbb-2 UTR]
Plasmid#200326Purposegfp BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00003755, nlp-17Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH47 - [ADLp | mScarlet | tbb-2 UTR]
Plasmid#200323PurposemScarlet BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | wrmscarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00011644, T09B9.3Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH80 - [AWAp | gfp | tbb-2 UTR]
Plasmid#200354Purposegfp BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00006109, str-44Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00011327, hlh-34Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
Plasmid#200353PurposemScarlet BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00006109, str-44Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR]
Plasmid#200337PurposemScarlet BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001535, gcy-8Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
ExpressionWormPromoter15xUAS::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB88
Plasmid#199321PurposeCombine with Gal4 to direct TeNL expressionDepositorInsert15xUAS::delta pes-10::::TeNL::let-858 3'UTR
ExpressionWormMutationKD for calcium is 250 nM, 1 synthetic intronPromoter15xUAS::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
ExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
Tags2xHAExpressionWormPromoterrpl-21 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
Tags2xFLAGExpressionWormPromotercsr-1 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmCardinal-T2A-HO1
Plasmid#197249PurposeExpresses the protein of wmCardinal-T2A-HO1 in neurons of C. elegansDepositorInsertwmCardinal-T2A-HO1
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP720-T2A-HO1
Plasmid#197248PurposeExpresses the protein of wmiRFP720-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP720-T2A-HO1
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmNeonGreen
Plasmid#197242PurposeExpresses the protein of wNeonGreen in neurons of C eleganDepositorInsertwmNeonGreen
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH86 - [AWCp | gfp | tbb-2 UTR]
Plasmid#200360Purposegfp BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00012770, srt-47Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH82 - [PVTp | gfp | tbb-2 UTR]
Plasmid#200356Purposegfp BioPart for PVT neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVTp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00006979, zig-2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH84 - [AVHp | gfp | tbb-2 UTR]
Plasmid#200358Purposegfp BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00011327, hlh-34Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH81 - [PVTp | wrmScarlet | tbb-2 UTR]
Plasmid#200355PurposemScarlet BioPart for PVT neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVTp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00006979, zig-2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH46 - MosTI [unc-119(partial) | MCS | gfp]
Plasmid#200366PurposeCloning vector for mosTI(unc-119, gfp). MCS or Golden Gate.DepositorTypeEmpty backboneExpressionWormAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH59 - [ASELp | wrmScarlet | tbb-2 UTR]
Plasmid#200333PurposemScarlet BioPart for ASEL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASELp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001533, gcy-6Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH89 - [AWCp | wrmScarlet | tbb-2 UTR]
Plasmid#200363PurposemScarlet BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00016049, srt-28Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH88 - [IL2LRp | gfp | tbb-2 UTR]
Plasmid#200362Purposegfp BioPart for IL2LR neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[IL2LRp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00015977,C18f10.2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH87 - [IL2LRp | wrmScarlet | tbb-2 UTR]
Plasmid#200361PurposemScarlet BioPart for IL2LR neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[IL2LRp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00015977,C18f10.2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH90 - [AWCp | gfp | tbb-2 UTR]
Plasmid#200364Purposegfp BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00016049, srt-28Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH45 - MosTI [unc-119(partial) | MCS | wrmScarlet]
Plasmid#200365PurposeCloning vector for mosTI(unc-119, wrmScarlet). MCS or Golden Gate.DepositorTypeEmpty backboneExpressionWormAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH58 - [ASERp | gfp | tbb-2 UTR]
Plasmid#200332Purposegfp BioPart for ASER neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASERp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00001532, gcy-5Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH57 - [ASERp | wrmScarlet | tbb-2 UTR]
Plasmid#200331PurposemScarlet BioPart for ASER neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASERp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001532, gcy-5Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH54 - [AVKp | gfp | tbb-2 UTR]
Plasmid#200330Purposegfp BioPart for AVK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVKp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00018002, twk-47Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH53 - [AVKp | wrmScarlet | tbb-2 UTR]
Plasmid#200329PurposemScarlet BioPart for AVK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVKp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00018002, twk-47Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH52 - [DDp | gfp | tbb-2 UTR]
Plasmid#200328Purposegfp BioPart for DD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[DDp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00007304, ttr-39Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH48 - [ADLp | gfp | tbb-2 UTR]
Plasmid#200324Purposegfp BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00011644, T09B9.3Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH62 - [ASELp | gfp | tbb-2 UTR]
Plasmid#200336Purposegfp BioPart for ASEL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASELp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00001534, gcy-7Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH74 - [ASKp | gfp | tbb-2 UTR]
Plasmid#200348Purposegfp BioPart for ASK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASKp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00005033, sra-7Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH70 - [OLQp | gfp | tbb-2 UTR]
Plasmid#200344Purposegfp BioPart for OLQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[OLQp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00003841, ocr-4Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH69 - [OLQp | wrmScarlet | tbb-2 UTR]
Plasmid#200343PurposemScarlet BioPart for OLQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[OLQp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00003841, ocr-4Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH73 - [ASKp | wrmScarlet | tbb-2 UTR]
Plasmid#200347PurposemScarlet BioPart for ASK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASKp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00005033, sra-7Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH75 - [ADFp | wrmScarlet | tbb-2 UTR]
Plasmid#200349PurposemScarlet BioPart for ADF neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADFp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00005359, srh-142Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH68 - [PVPp | gfp | tbb-2 UTR]
Plasmid#200342Purposegfp BioPart for PVP neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVPp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00003840, ocr-3Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only