We narrowed to 9,067 results for: sgRNA
-
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-PLXNB2
Plasmid#69240PurposeU6 driven SpCas9 sgRNA expression for PLXNB2 siteDepositorAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIF1079
Plasmid#237445PurposeExpression SpCas9 and Efe1-RT from bidirectional CAG promoters. SpCas9 sgRNA and Efe1 non-coding expression is driven by U6 and H1 respecitvely.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9
Efe1-RT
EMX1 sgRNA
Efe1-ncRNA targeting EMX1
Tags3xFLAGExpressionMammalianPromoterCAG, H1, and U6Available sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD426
Plasmid#202079PurposeFrame +1/-0 selector for NHEJ knock-inDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpEF1a-mCherry-Cas9 + Frame +1/-0 sgRNA
UseCRISPRPromoterEF1aAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo sgTREX1
Plasmid#127645PurposeKnock-out of human TREX1 with NeoRDepositorInsertTREX1 sgRNA (TREX1 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-1
Plasmid#86130PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 1 targeting C1orf27 (C1orf27 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-2
Plasmid#86131PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 2 targeting C1orf27 (C1orf27 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459-TDP-43 sgRNA1
Plasmid#133762PurposeExpresses Cas9 and human TDP-43 sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTDP-43 (TARDBP Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i
Plasmid#233080PurposeExpression vector for sgRNA-S1b and eCas12f1iDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1i-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TO-dCas9
Plasmid#75381PurposedCas9DepositorInsertSp dCas9
UseLentiviralTagsnoExpressionMammalianPromoterCMV-TOAvailable sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0089
Plasmid#117565PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting {AT1G68250} in A. thalianaDepositorInsertPromoter_AtU6-26 + sgRNA_{AT1G68250} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-pU6-sgRNA
Plasmid#159174PurposeVector B encodes pAAV-pMecp2-dSaCas9-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of dSaCas9-sgRNA in neuronsDepositorInsertdSaCas9
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available sinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA1
Plasmid#164932PurposeExpresses EGFP sgRNA1 in mammalian cellsDepositorInsertsgRNA1 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_TOP1
Plasmid#68423PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.CYRANO
Plasmid#128755PurposeExpresses CYRANO gRNA for CRISPRiDepositorAvailable sinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only