We narrowed to 2,758 results for: ada.2
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-BSD
Plasmid#174819PurposeMammalian expression of SpCas9 prime editor 2 with P2A-BSD markerDepositorInsertPE2-P2A-BSD
TagsP2A-BSD and SV40 bpNLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ATF4
Plasmid#192911PurposeBarcoded piggybac transposon vector with Dox-inducible expression of ATF4DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SM
Plasmid#136578PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(280-342)
Plasmid#72550Purposeexpresses 3*FLAG tagged human NSD3-short with 280-342 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutation280-342 aa deletionPromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(384-645)
Plasmid#72549Purposeexpresses 3*FLAG tagged human NSD3-short with 384-645 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutation384-645 aa deletionPromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(100-263)
Plasmid#72548Purposeexpresses 3*FLAG tagged human NSD3-short with 100-263 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3xFlag and SV40 NLSExpressionMammalianMutation100-263 aa deletionPromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-GST-6P2-LTLT-KIF1C(642–922)-GFP-6His
Plasmid#222288PurposeExpression of KIF1C stalk with N-terminal GST (cleavable) and C-terminal GFP and His tag in E.coli for purification.DepositorInsertKIF1C (KIF1C Human)
Tags6xHis, GFP, and GSTExpressionBacterialMutationstalk region only amino acids 642 to 922PromoterT7Available SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-GST-6P2-LTLT-KIF1C(642–922)-6His
Plasmid#222289PurposeExpression of KIF1C stalk with N-terminal GST (cleavable) and C-terminal 6xHis tag in E.coli for purification.DepositorInsertKIF1C (KIF1C Human)
Tags6His and GSTExpressionBacterialMutationstalk region only amino acids 642 to 922PromoterT7Available SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEP4 TAPBPR-TM-TN6
Plasmid#178650PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TM (E205K, R207E, Q209S, Q272S)DepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationE205K, R207E, Q209S, Q272S, switched transmembran…PromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SK
Plasmid#136577PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, Klf4DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KS
Plasmid#136617PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-M85E-3XHA
Plasmid#242416PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a M85E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only