We narrowed to 25,897 results for: Nes
-
Plasmid#209711PurposeMammalian expression of c-ATOM biosensor for HRas with nuclear export signalDepositorInsertNES-MBP-cATOM(Ras)
TagsNES-MBPExpressionMammalianAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
867 pSG5L HA NES PTEN G129R
Plasmid#10934DepositorAvailable SinceJan. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-BirA(R118G)-NES-YFP
Plasmid#127363PurposeBinary vector for expressing cytosolic BirA* (R118G)-YFP under the UBQ10 promoter in plantsDepositorInsertBirA* (R118G mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationR118GPromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-PKAsub-RLuc8N-NES
Plasmid#138211PurposeEncodes substrate fragment of luminescence-based bimolecular PKA activity reporter (LumAKAR); cytosol targeted. Use in conjunction with pcDNA3-RLuc8C-FHA1-NES.DepositorInsertmCherry-PKAsub-RLuc8N-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt Mouse, HIV)
TagsmycExpressionMammalianMutationK294APromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Nrxn-V5-TurboID-NES
Plasmid#250172PurposeMembrane-TurboID variant for neuron expressionDepositorInsertNrxn (NRXN1 Human)
UseAAVTagsHA (internal) and V5-TurboID-NESExpressionMammalianPromoterhSynAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2234 - pAAV Nestin GFP-iCre
Plasmid#228443PurposeAn adeno-associated viral vector to express GFP-iCre fusion protein under the human Nestin 2nd intron enhancer.DepositorInsertGFP-iCre
UseAAVExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
(nested-DIAL-YB_TATA)-mGL-BGH_pKG2876
Plasmid#246332Purposenested DIAL Reporter Plasmid with YB_TATA expressing mGreenLantern in the presence of ZFa and editable by Cre and VCre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-HyPerFLEX-NES-WPRE
Plasmid#217562PurposeMammalian expression of HyPerFLEX targeted to the cytoplasmDepositorInsertHyPerFLEX-NES
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-MLLn-CAGEn-NES (Nrdj1)
Plasmid#241412PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-MLLn-CAGEn-NES (Npu)
Plasmid#241411PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Nrdj1)
Plasmid#241408PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Figure 2 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-AF9c (Npu)
Plasmid#241413PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-AF9c (Npu) (MLLT3 Human, Synthetic)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-ETOc (Npu)
Plasmid#241409PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Extended Figure 3 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-ETOc (Npu) (RUNX1T1 Human, Synthetic)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-HOXA9c (Nrdj1)
Plasmid#241416PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-HOXA9c (Nrdj1) (HOXA9 Human, Synthetic)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-AF9c (Nrdj1)
Plasmid#241414PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-AF9c (Nrdj1) (MLLT3 Human, Synthetic)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-HOXA9c (Npu)
Plasmid#241415PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-HOXA9c (Npu) (HOXA9 Human, Synthetic)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Npu)
Plasmid#241417PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Npu)
Plasmid#241407PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Extended Figure 3 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV:: NES-FKBP-iLID-LRP6c(△1-64)
Plasmid#221775PurposeExpresses NES-FKBP-iLID-LRP6c(△1-64) component in mammalian cellsDepositorInsertpCMV:: NES-FKBP-iLID-LRP6c
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-3XFLAG-NESm-NFATC2IP
Plasmid#221445PurposeMammalian expression vector of triple Flag tagged NFATC2IP ORF with mutant nuclear export signal (NESm) at N-terminusDepositorInsertNFATC2IP (NFATC2IP Human)
Tags3XFlag and Mutant Nuclear Export Signal (mNES)ExpressionMammalianMutationmutant NES (NESm: NLVDLQKKLEEAKADEQQ (PMID: 10739…PromoterCMVAvailable SinceJuly 3, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT/T0-eGFP-NES-NFATC2IP
Plasmid#221446PurposeMammalian expression vector of eGFP tagged NFATC2IP ORF with nuclear export signal (NES) at its N-terminusDepositorInsertNFATC2IP (NFATC2IP Human)
TagsNuclear Export Signal (NES) and eGFPExpressionMammalianMutationNES (NLVDLQKKLEELELDEQQ) inserted, 1st Methionine…PromoterCMVAvailable SinceJuly 3, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT/T0-3XFLAG-NES-NFATC2IP
Plasmid#221444PurposeMammalian expression vector of triple Flag tagged NFATC2IP ORF with nuclear export signal (NES) at its N-terminusDepositorInsertNFATC2IP (NFATC2IP Human)
Tags3XFlag and Nuclear Export Signal (NES)ExpressionMammalianMutationNES (NLVDLQKKLEELELDEQQ)inserted, 1st Methionine …PromoterCMVAvailable SinceJuly 3, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTol2_elavl3(HuC)_NES-Caprola_on-mEGFP
Plasmid#194697PurposeHuC driven expression of the consitutively active calcium recorder positive control Caprola_on fused to mEGFP for neuronal expression in zebrafishDepositorInsertCaprola_on-mEGFP
UseZebrafish expressionTagsmEGFPPromoterelavl3(HuC)Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol2_elavl3(HuC)_NES-Caprola_off-mEGFP
Plasmid#194698PurposeHuC driven expression of the inactive calcium recorder negative control Caprola_off fused to mEGFP for neuronal expression in zebrafishDepositorInsertCaprola_off-mEGFP
UseZebrafish expressionTagsmEGFPPromoterelavl3(HuC)Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-20XUAS-IVS-NES_Caprola5-mEGFP
Plasmid#205704PurposeGal4 driven expression of EGFP-Caprola5 for targeted expression in Drosophila fliesDepositorInsertCaprola5-EGFP
ExpressionInsectPromoter20 Gal4Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT mCh-V5-NES-EGFP-mCBP80
Plasmid#192313PurposeGateway entry vector for an inducible mCh-V5-NES-EGFP-mCBP80DepositorInsertmCh-V5-NES-EGFP-mCBP80
UseGateway CloningTags3xFLAGAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT mCh-V5-NES-EGFP-IBB
Plasmid#192314PurposeGateway entry vector for an inducible mCh-V5-NES-EGFP-IBBDepositorInsertmCh-V5-NES-EGFP-IBB
UseGateway CloningTags3xFLAGAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-myc-OGA(GS-544)C181_NES
Plasmid#193998Purposeplasmid encoding myc-tagged OGA(GS-544)C181_NESDepositorInsertmyc-OGA(GS-544)C181_NES
TagsmycExpressionMammalianAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS2-3xFLAG-2xNLS
Plasmid#107303PurposeExpresses ZFP-VEGFA-TS2 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS2
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS3-3xFLAG-2xNLS
Plasmid#107304PurposeExpresses ZFP-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS3
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-PKCsub-RLuc8N-NES
Plasmid#138213PurposeEncodes substrate fragment of luminescence-based bimolecular PKC activity reporter (LumCKAR); cytosol targeted. Use in conjunction with pcDNA3-RLuc8C-FHA1-NES.DepositorInsertmCherry-PKCsub-RLuc8N-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-PKCsub(T/A)-RLuc8N-NES
Plasmid#138299PurposeEncodes negative-control substrate fragment of luminescence-based bimolecular PKC activity reporter (LumCKAR); cytosol targeted. Use in conjunction with pcDNA3-RLuc8C-FHA1-NES.DepositorInsertmCherry-PKCsub(T/A)-RLuc8N-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#101061PurposeAAV vector expressing CaMPARI2_F391W (Kd = 110nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2-F391W
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40
Plasmid#101064PurposeAAV vector expressing CaMPARI2_L398T (Kd = 825nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2_L398T
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-FRCaMPi-P2A-mGreenLantern
Plasmid#232841PurposeAAV transfer plasmid for CAG-mediated co-expression of FRCaMPi and mGreenLanternDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-miRFP680-NES-p2A-dTomato-2xrGBD
Plasmid#222638PurposeRho reporterDepositorInsertmiRFP680-NES-p2A-dTomato-2xrGBD
UseLentiviralPromoterEF1aAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-APEX.NES-P2A-EGFP
Plasmid#182824PurposeCre-dependent expression of cytosolic APEXDepositorInsertAPEX.NES-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-H396K-WPRE-SV40
Plasmid#101062PurposeAAV vector expressing CaMPARI2_H396K (Kd = 360nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertCaMPARI2-H396K
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P2R-P3_R2-Turbo-NES-mVenus-STOP-L3
Plasmid#127353Purposegateway entry vector for making C-terminal TurboID-mVenus fusion with non-nuclear proteinsDepositorInsertTurboID (BirA mutant)
UseGateway CloningTagsGS linker, NES, V5, and mVenusMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-mTagBFP2-P2A-DAAO-NES
Plasmid#217566PurposeExpression of DAAO targeted to the cytoplasm and mTagBFP2, separated by P2A self-cleaving peptide, in mammalian neuronsDepositorInsertTagBFP2-P2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloAKAR2.1-NES-T2A-EGFP-CAAX
Plasmid#216491PurposeExpression of chemigenetic PKA biosensor (medium basal brightness, high dynamic range) and PM targeted EGFP in mammalian cellsDepositorInsertHaloAKAR2.1
TagsNES, T2A-EGFP-CAAXExpressionMammalianPromoterCMVAvailable SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only