We narrowed to 4,337 results for: U6 gRNA
-
Plasmid#213016PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (tRNA-Gln and synthetic U6)DepositorInserttRNAGln promoter, sU6 promoter, gRNA scaffolds
UseTagsExpressionMutationPromotertRNAGln promoterAvailable sinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OSK2M2L1-PP
Plasmid#102902PurposeEBNA episome plasmid for U6 promoter-driven expression of 10 gRNAs targeting OCT4, MYC, KLF4, SOX2 and LIN28A promoters. Includes PGK-puro selection cassette.DepositorInsertOSK2M2L1-gRNAs-PGK-puro
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM
Plasmid#92220PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sitesDepositorInsertsSp-dCas9-2xAM tag
gRNA to be inserted into Bbs I sites
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6T7
Plasmid#71462PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (2 Gs at initiation)DepositorTypeEmpty backboneUseCRISPRTagsExpressionBacterial and MammalianMutationPromoterhuman U6/phage T7Available sinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6T7G
Plasmid#71463PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (1 G at initiation)DepositorTypeEmpty backboneUseCRISPRTagsExpressionBacterial and MammalianMutationPromoterhuman U6/phage T7Available sinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWT062e
Plasmid#107910PurposeW2m.2-3 plasmid. Contains U6-LacI-sgRNA A and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-LacI-sgRNA A
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT060f
Plasmid#107907PurposeW2m.1-2 plasmid. Contains U6-sgRNA D (CCR5) and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-sgRNA D (CCR5)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42229PurposeThis plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-EEA-5guides-PGK-Puro
Plasmid#102898PurposeEBNA episome plasmid for U6 promoter-driven expression of 5 gRNAs targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-5guides-PGK-Puro
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only