We narrowed to 46,218 results for: cha

#64880

lentiviral expression of human POLQ double mutant (in POL and HDL domains)

Richard Wood

Yousefzadeh et al PLoS Genet. 2014 Oct 2;10(10):e1004654.

July 11, 2016

Academic Institutions and Nonprofits only

#239616

CytoTape timestamp monomer (HaloTag fused to CytoTape-HA) for encoding time along the CytoTape fiber for cell culture applications.

Changyang Linghu

Zheng et al Nature. 2026 Jan 26. doi: 10.1038/s41586

Nov. 12, 2025

Industry, Academic Institutions, and Nonprofits

#196419

Cre-dependent AAV expression of membrane-targeted V5 spaghetti monster reporter preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassette

Stanley Thomas Carmichael

Gleichman et al Nat Commun. 2023 Nov 16;14(1):7426. doi:

Feb. 23, 2023

Academic Institutions and Nonprofits only

#49498

Expresses HA-tagged ER wild-type in mammalian cells

Sarat Chandarlapaty

Toy et al Nat Genet. 2013 Dec;45(12):1439-45. doi:

Dec. 12, 2013

Academic Institutions and Nonprofits only

#110301

Mammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)

Chris Kok-Lung Chan

Tiwari et al Nat Commun. 2018 Feb 14;9(1):677. doi: 1

May 23, 2018

Academic Institutions and Nonprofits only

#242229

Expression of full-length human SF-1 using lentivirus

Courtney Hodges

Chan et al Mol Cell. 2025 Jul 15:S1097-2765(25)0057

Sept. 9, 2025

Academic Institutions and Nonprofits only

#162279

Eukaryotic expression of human SCN2A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.

Al George

DeKeyser et al J Biol Chem. 2021 Jan-Jun;296:100298. do

Jan. 19, 2021

Academic Institutions and Nonprofits only

#119946

Expresses 5'TOP-SunTag-Renilla mRNA reporter in mammalian cells; note plasmid contains 24xGCN4 repeats

Jeffrey Chao

Wilbertz et al Mol Cell. 2019 Jan 4. pii: S1097-2765(18

March 20, 2019

Academic Institutions and Nonprofits only

#223735

Expression of recombinant protein for purification

Sascha Martens

Adriaenssens et al Nat Cell Biol. 2025 Jul 25. doi: 10.1038

March 25, 2025

Academic Institutions and Nonprofits only

#26810

Jeffrey Chamberlain

Kimura et al Hum Mol Genet. 2008 Aug 15. 17(16):2507-

Sept. 12, 2011

Academic Institutions and Nonprofits only