We narrowed to 14,172 results for: cas9
-
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair2
Plasmid#98973PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 96bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 2 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0212_Cq-nanos-Cas9
Plasmid#169348PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0212_Cq-nanos-Cas9
UseCRISPRExpressionInsectPromoterCPIJ011551Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0173_Cq-Actin5c-Cas9
Plasmid#169345PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0173_Cq-Actin5c-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009808Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0213_Cq-vasa-Cas9
Plasmid#169347PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0213_Cq-vasa-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009286Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Dual-Guide-Donor-Cas9-H2B-mCherry
Plasmid#175570PurposeDonor shuttle plasmid to enable ligation of a second U6-GuideRNA casssette into any pX458 family backbone via digestion of both plasmids with XbaI and KpnI.DepositorTypeEmpty backboneUseCRISPRMutationXbaI site added upstream of U6 promotor. G to C …Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTG110
Plasmid#237396PurposePeft-3::Cas9 + ChrIV sgRNADepositorInsertPeft3::Cas9 + ChrIV sgRNA
Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-His:dCas9:nls:10P3
Plasmid#135982PurposeExpresses dCas9 fused to 10 copies of the P3 coiled coil in mammalian cellsDepositorInsertdCas9 fused to 10 copies of the P3 coiled-coil
UseCRISPRTagsHisExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-spCas9-WPRE-miR124T
Plasmid#245071PurposeCRISPR Editing with SpCas9, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertCas9, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH397
Plasmid#230853PurposeEf1a-AID*-n'Cas9-T2A-BlastR-wPREDepositorInsertAID*-n'Cas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH398
Plasmid#230854PurposeEf1a-rAPOBEC1-n'Cas9-T2A-BlastR-wPREDepositorInsertrAPOBEC1-n'Cas9
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-TLCV2
Plasmid#196331Purposethe TLCV2 plasmid with Tol2 recombination sites for integrationDepositorInsertCas9-2A-eGFP
UseCRISPR; Fish expressionExpressionBacterial, Mammalian, and Y…PromoterTight TRE promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpCas9 nickase for Split-PE (pJUL2497)
Plasmid#190104PurposeExpresses nickase SpCas9(H840A) for Split-PE useDepositorInsertnSpCas9
TagsXTEN-bpNLS and bpNLSExpressionMammalianMutationH840APromoterCMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pD10AH840AhCas9 (GB1041)
Plasmid#68207PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid partDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removed; human codon optimis…Available SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only