We narrowed to 4,533 results for: ARA-2
-
Plasmid#214405PurposeExpresses a control non-specific microRNA in tandem with mRFP1DepositorInsertmRFP1 with non-specific control miRNA
UseAAVAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET21a HsDHFR-bio-10His
Plasmid#193883PurposeExpresses human dihydrofolate reductase (DHFR) with C-terminal AviTag (Bio) and His10 sequenceDepositorInserthuman dihydrofolate reductase (DHFR) (DHFR Human)
TagsHis tag and biotinylation sequenceExpressionBacterialMutationCodon optimizedPromoterT7Available SinceOct. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Quartet_NoLinker
Plasmid#214731PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV-2 with no linkers between the RBDs and an N-terminal SpyTagDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx26G45E-IRES-GCaMP6s
Plasmid#188237Purpose3rd generation, inducible bicistronic lentiviral plasmid for expression of human connexin 26 variant p.G45E and GCaMP6sDepositorInsertGJB2 (GJB2 Human)
UseLentiviralExpressionMammalianMutationp.G45EPromoterTight TRE promoterAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMECP2-RFP
Plasmid#181905PurposeFluorescently tagged MECP2, RFPDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-2R-2K+3D
Plasmid#178680PurposeBacterial expression of N-terminally 6His tagged A1-LCD with two Arg residues removed, two Lys removed, three Asp added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-2R+2K+3D (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationtwo Arg residues removed, two Lys added, three As…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+7K+12D
Plasmid#178679PurposeBacterial expression of N-terminally 6His tagged A1-LCD with seven Lys residues added, twelve Glu residues added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+7K+12D (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationseven Lys residues added, twelve Glu residues add…Available SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-4R-2K+5D
Plasmid#178681PurposeBacterial expression of N-terminally 6His tagged A1-LCD with four Arg residues removed, two Lys removed, five Asp added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-4R+2K+5D (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationfour Arg residues removed, two Lys added, five As…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+7R+10D
Plasmid#178677PurposeBacterial expression of N-terminally 6His tagged A1-LCD with seven Arg residues added, ten Glu residues added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+7R+10D (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationseven Arg residues added, ten Glu residues addedAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SMARCA4
Plasmid#65391PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-TAF1
Plasmid#65395PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1beta
Plasmid#181901PurposeFluorescently tagged HP1betaDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Human, Synthetic)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PGL-1-mHP1alpha
Plasmid#181899PurposeFluorescently tagged HP1alpha fused to PGL-1DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-30G+30S-12F+12Y
Plasmid#178687PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S-12F+12Y (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, twelve Phe…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-30G+30S+7F-7Y
Plasmid#178686PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S+7F-7Y (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, seven Tyr …Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only