We narrowed to 5,334 results for: pAAV
-
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP1-WPRE
Plasmid#193917PurposeExpresses one of the components of Cre-DOR_N6C1 (RFP-dependent Cre)DepositorInsertCCre-MBP1
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP6-WPRE
Plasmid#193916PurposeExpresses one of the components of Cre-DOR_N6C1 (RFP-dependent Cre)DepositorInsertNCre-MBP6
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn CCL20-pre-mGRASP
Plasmid#173117PurposeExpresses CCL20 sender construct in neuronsDepositorInsertCCL20-pre-mGRASP
UseAAVPromoterSynapsinAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
78_pAAV-ProA27-CatCh-GFP-WPRE
Plasmid#125910PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA27Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-jGCaMP7c variant 1513
Plasmid#173159PurposeExpresses jGCaMP7c variant 1513 in astrocytesDepositorInsertjGCaMP7c variant 1513-WPRE
UseAAVPromoterGFAPAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
45_pAAV-ProC10-CatCh-GFP-WPRE
Plasmid#125945PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC10Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pgk-DIO-rvCRY-WPRE
Plasmid#182060PurposePlasmids for production of AAV-based TFactivity reporterDepositorInsertmCherry
UseAAVPromoterhu Pgk1Available SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321A
Plasmid#115342PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321ADepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV1-EF1α-F-Flex-jGCaMP7b-WPR
Plasmid#171689PurposeFlp-dependent expression of jGCaMP7bDepositorInsertGCaMP7b
UseAAVAvailable SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
193_pAAV-ProA35-CatCh-GFP-WPRE
Plasmid#125918PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA35Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
105_pAAV-ProC16-CatCh-GFP-WPRE
Plasmid#125951PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC16Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKIIa-C1V1::FusionRed::Kv2.1
Plasmid#102771Purpose"Activate neurons with 2p stimulation"DepositorInsertC1V1::FusionRed::Kv2.1
UseAAVTagsFusionRed and Kv2.1 traficking domainAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnj6
Plasmid#159913PurposeMutagenesis of Kcnj6DepositorInsertKcnj6 (Kcnj6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
194_pAAV-ProB15-CatCh-GFP-WPRE
Plasmid#125935PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB15Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
216_pAAV-ProD24-CatCh-GFP-WPRE
Plasmid#126000PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD24Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
27_pAAV-ProB12-CatCh-GFP-WPRE
Plasmid#125932PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB12Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only