We narrowed to 2,453 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS
Plasmid#98566PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationIn a synthetic operon downstream of UBP1 and Remo…PromoterSame as UBP1 (operon) and Tet promoter (aTc induc…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Mouse, Synthetic)
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV-218_HNF4A2
Plasmid#31090DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-68_HNF4A2
Plasmid#31092DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMiR-E6AP-3'UTR-miR-375-mut
Plasmid#53695PurposeLuciferase reporter assay for E6AP 3'UTR with point mutation on miR-375 binding siteDepositorInsertUBE3A 3'UTR (UBE3A Human)
UseLuciferaseMutationMutation on miR-375 binding site on E6AP 3'U…Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-138_HNF4A2
Plasmid#31091DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/S647A
Plasmid#74938PurposeMammalian expression of human NSF mutant S647A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationS647A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
P2_DD-HNF4A8
Plasmid#31095DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsFKBP L106P and mycExpressionMammalianMutationsplice variant 8 derived from promoter P2Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-CRY2-STIM1(238-685)
Plasmid#248293PurposeAn expression construct encoding a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238–685).DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238–685) (STIM1 )
TagsFLAGMutationdeleted amino acids 1-237PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CIBN-STIM1(238-685)
Plasmid#248296PurposeAn expression construct encoding a CIBN-fused STIM1 fragment (a.a.238-685).DepositorInsertCIBN-fused STIM1 fragment (a.a.238-685) (STIM1 Human)
TagsCIBNExpressionMammalianMutationdeleted amino acids 1-237PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-CRY2-STIM1(318-450)
Plasmid#248294PurposeAn expression construct encoding a CRY2-fused truncated STIM1 fragment (a.a.318–450).DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 )
TagsEGFPMutationdeleted amino acids 1-317,451-685PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-SpCas9-HF1
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1b
Plasmid#176021PurposeLeishmania cell free expression of zebrafish EGFP-Bin1b. Parton lab clone GRSDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only