We narrowed to 28,248 results for: CAL
-
Plasmid#202418PurposeExpression of GFP-tagged PODXL PDZ-binding motif mutation (PBM; doesn't bind NHERF1/2) fused to EZRINDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-KozATG-dL5-2XG4S-actin
Plasmid#73262PurposeExpresses dL5(E52D)-actin fusion within mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertKozATG-dL5-2XG4S-actin (ACTB Synthetic, Human)
TagsThe FAP and actin are fused with 2 copies of a G4…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninΔβH
Plasmid#229705PurposeTransient expression of GFP-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+
Plasmid#229697PurposeTransient expression of GFP-alpha-cateninA+ in mammalian cells; enhanced actin bindingDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+
Plasmid#229703PurposeLentiviral expression of iRFP670-alpha-cateninA+ in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta PBM + FBM
Plasmid#202416PurposeExpression of GFP-tagged PODXL PDZ-binding and FERM-binding motif mutationDepositorInsertPODXL (PODXL Human)
UseLentiviralTagsGFPMutationLacking DTHL, and H477/R479/S481>AAA mutationAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL FKBP 4K>R
Plasmid#202421PurposeExpression of ubiquitination-deficient GFP-tagged PODXL with FKBP-rapamycin binding (FRB) dimerization domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-KozATG-dH6.2-2XG4S-actin
Plasmid#73263PurposeExpresses dH6.2-actin fusion within mammalian cells. (dH6.2, FAP)DepositorInsertKozATG-dH6.2-2XG4S-actin (ACTB Synthetic, Human)
TagsThe FAP and actin are fused with 2 copies of a G4…ExpressionMammalianMutationThe dH6.2 FAP has one cysteine in each domain cha…PromoterCMVAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLViN-iRFP670-α-cateninΔβH
Plasmid#229706PurposeLentiviral expression of iRFP670-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninV-
Plasmid#229696PurposeTransient expression of GFP-alpha-cateninV- in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationL344PPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML390_YWHAQ-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227925PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertYWHAQ homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML389_YWHAB-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227926PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertYWHAB homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML600_COG8-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227911PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertCOG8 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML357_CAV1-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227914PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertCAV1 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML361_DCP1A-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227918PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertDCP1A homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only