We narrowed to 643 results for: Adh1
-
Plasmid#212751PurposeConstitutive expression of NUbo-E3(63)-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and VSVExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-VSV
Plasmid#212750PurposeConstitutive expression of NUbo-E3(63)-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and VSVExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212749PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212748PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-NLS-VSV
Plasmid#212745PurposeConstitutive expression of NUbo-E3(48)-NLS-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48)-VSV
Plasmid#212742PurposeConsitutive expression of NUbo-E3(48)-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and VSVExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-VSV
Plasmid#212741PurposeConsitutive expression of NUbo-E3(48)-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsVSVExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1)-CUbo-VSV
Plasmid#212736PurposeConsitutive expression of myc-E3(1)-CUbo-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-VSV and mycExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-myc-E3(1)-CUbo-VSV
Plasmid#212735PurposeConsitutive expression of myc-E3(1)-CUbo-VSV in budding yeastDepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-VSV and mycExpressionYeastMutationPromoterADH1Available sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-γ1 ear
Plasmid#199177PurposeExpression of GAL4 DNA-binding domain (BD)-AP-1 γ1 ear domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-1 γ1 ear domain (Ap1g1 Mouse)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationPromoterADH1Available sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAD424-Rabex-5
Plasmid#197043PurposeExpression of GAL4 transcriptional activation domain (AD)-Rabex-5 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertRabex-5 (RABGEF1 Bovine)
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationPromoterADH1Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-ubiquitin
Plasmid#196999PurposeExpression of GAL4 DNA-binding domain (BD)-ubiquitin fusion protein in yeast (yeast two-hybrid assays)DepositorInsertubiquitin (UBC Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationPromoterADH1Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-N (LEU2)
Plasmid#177798PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-N (TRP1)
Plasmid#177797PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH732-2µ-RLuc/staCFLuc
Plasmid#40607DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook3
Plasmid#198525PurposeExpression of GAL4 DNA-binding domain (BD)-Hook3 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook3 (HOOK3 Human)
UseTagsGAL4-DNA binding domain (BD) fragmentExpressionYeastMutationPromoterADH1Available sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only