We narrowed to 4,332 results for: U6 gRNA
-
Plasmid#62127PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L4
Plasmid#62129PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L2
Plasmid#62130PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI large stuffer
Plasmid#52628Purposelentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiencyDepositorInsertKanamycin cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianMutationPromoterU6Available sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA1
Plasmid#117405PurposeSpyCas9 sgRNA 1 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179117PurposeExpresses Fermt2 sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertFermt2 sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2
Plasmid#117406PurposeSpyCas9 sgRNA 2 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-AsCas12a-TLR-MCV1-gRNA
Plasmid#117411PurposeAsCas12a-gRNA targeting TLR2.0DepositorInsertAsCas12a gRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract
Plasmid#138525PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt control A-tract repeat RNA sequence.DepositorInsertControl non-PRC2 binding A-tract repeat RNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
1531_pAAV-U6-SA-Self1-gRNA-HLP-EmGFP-spA
Plasmid#109318PurposePlasmid for liver-specific expression of EmGFP with a gRNA against SaCas9DepositorInsertSaCas9 RuvC gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1(D908A)-2A-GFP-U6-AAVS1-sgRNA
Plasmid#194727PurposeCAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vector, with guide RNA array targeting hAAVS1.DepositorArticleInsertAsCpf1(D908A) (AAVS1 Acidaminococcus sp.)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri-U6-Camk2d sgRNA7
Plasmid#220127PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauriCas9
UseAAVTagsHA tagExpressionMutationPromoterMYL2Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only