We narrowed to 13,129 results for: lic
-
Plasmid#118811PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only
-
(PM-S608E)FLAG-Cep215-FL
Plasmid#106906PurposeExpresses murine phospho-mimetic CEP215 at S608DepositorInsertCEP215 (Cdk5rap2 Mouse)
TagsFLAGExpressionMammalianMutationchanged Serine-608 to Glutamic AcidPromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPTXGARE
Plasmid#68542Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with GARE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation5x GARE inserted 190 bp 5' pf ATG (GARE = ta…PromoterOPTX promoter with GAREAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pP[RS3]3'M
Plasmid#53552Purposefor an easy screen of TALEN- and CRISPR/Cas9- mediated mutagenesis in DrosophilaDepositorInsertAscI and MluI restriction enzyme sites
ExpressionInsectPromotersame pP[RS3]Available SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).cpSFGFP.HaloTag
Plasmid#244109PurposeCytosolic expression of non-responsive circularly permuted Super Folder GFPDepositorInsertcpSFGFP
UseAAVTagsHaloTagAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2
Plasmid#244111PurposeCytosolic expression of green glucose sensorDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2
Plasmid#244078PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-TK2-3xFLAG
Plasmid#217427PurposeLentiviral overexpression of human TK2DepositorInsertTK2 (TK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert sequence is a codon-optimized gBLOCK (IDT)PromoterCMVAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_4
Plasmid#217431PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_5
Plasmid#217432PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgSHMT2
Plasmid#217435PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human SHMT2DepositorInsertsgRNA targeting SHMT2 (SHMT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Nova1-GFP
Plasmid#217033PurposeOverexpression of Nova in DRG neurons promotes the "mature" splicing pattern observed in CNS neuronsDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only