We narrowed to 656 results for: crispr v2
-
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_mCherry
Plasmid#229078PurposeSmall lentiviral backbone for CRISPR guide libraries, improved titre for hard to transduce cellsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterEF1sAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mPTK7-gRNA4
Plasmid#249199Purposemouse PTK7 CRISPR KODepositorAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mPTK7-gRNA3
Plasmid#249198Purposemouse PTK7 CRISPR KODepositorAvailable SinceFeb. 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.v2.TetON_Cas13d_U6_DR
Plasmid#196727PurposeSortable and selectable, Tet-inducible RfxCas13d with guide cassette (one vector system). Inducible knock-down.DepositorInsertRfxCas13d-T2A-miRFP670nano
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterTREAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pLentiCRISPRv2_hPTK7-gRNA2
Plasmid#249197Purposehuman PTK7 CRISPR KODepositorAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2R
Plasmid#167932PurposelentiCRISPRv2 variant with mScarlet-I fluorescence marker.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-Opti
Plasmid#163126PurposeLentiCRISPRv2 variant with modified sgRNA scaffold from Chen et al. 2013 Cell.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenticrispr-wt-ltr-puro
Plasmid#173428PurposeExpresses Cas9 and guide RNA, contains intact LTRDepositorInsertS. pyogenes sgRNA cassette
UseLentiviralExpressionMammalianAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only