We narrowed to 7,396 results for: tet on
-
Plasmid#125150PurposeVector to measure the activity of CP candidates in response to a tethered (4xUAS) GAL4-DBD-COF by determining the abundance of transcripts originating from each candidate in human cellsDepositorInsert4 x upstream activating sequence (UAS)
UseStap-seq screening vectorAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMRE163
Plasmid#118511Purposebroad-host range plasmid to constitutively express fluorescent protein genes in bacteriaDepositorInsertsYFP2
ExpressionBacterialAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFAB815
Plasmid#47854PurposeBIOFAB reporter plasmid for measuring rnpB T1 termination efficiencyDepositorInsertrnpB T1 terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO9Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPyCAG-HA-EGFP-Myc-TM-IRES-Pac
Plasmid#183605PurposeMammalian expression vector for membrane-tethered HA- and Myc-tagged EGFP from the CAG promoter. Confers puromycin resistance.DepositorInsertEGFP-TM
TagsHA, Human PDGFRB transmembrane domain, Mouse IgGK…ExpressionMammalianPromoterCAGAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRE160
Plasmid#118508Purposebroad-host range plasmid to constitutively express fluorescent protein genes in bacteriaDepositorInsertTagBFP2
ExpressionBacterialAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA-E2-Crimson
Plasmid#111258PurposeBroad host-range bacterial expression vector with constitutive PsbA promoter; for tagging bacteria with E2-CrimsonDepositorInsertE2-Crimson
ExpressionBacterialPromoterPpsbAAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2H12Matry-blind
Plasmid#221181PurposecdGreen-Matry(blind) expressed from an aTc-inducible promoter (Internal Lab ID: UJ11209)DepositorInsertcdGreen-Matry(blind)
ExpressionBacterialPromoterPtetAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB556
Plasmid#115966PurposeSGP insert for replicon MoCloDepositorInsertLvl0 -98/15 SGP 2xTetApt-STOP
UseSynthetic BiologyAvailable SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
JAB3312
Plasmid#190406PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_pro35S-AmtRO-PhlFO::GFPint-NLS-ADHt)DepositorInsertproUBQ10::PIP2A-mCherry-NOSt_pro35S-AmtRO-PhlFO::GFPint-NLS-ADHt
ExpressionPlantAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
JAB2602
Plasmid#190389PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_4XAmtRO::GFPint-NLS-ADHt)DepositorInsertproUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_4XAmtRO::GFPint-NLS-ADHt
ExpressionPlantAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-lacZYA
Plasmid#67037PurposePlasmid for Paph-lacZYA integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
lacZYA
UseConjugative bacterial vectorAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCph8
Plasmid#22869DepositorInsertpCph8
UseSynthetic BiologyExpressionBacterialMutationFirst 517 amino acids of Cph1 and the last 229 am…Available SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)
Plasmid#111253PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorA signal peptideDepositorInsertTorA signal peptide
ExpressionBacterialPromoterPcAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMRE166
Plasmid#118514Purposebroad-host range plasmid to constitutively express fluorescent protein genes in bacteriaDepositorInsertmCardinal
ExpressionBacterialAvailable SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCer-Vamp2(qv/fw)
Plasmid#53238PurposeMutant (Q76V/F77W), tetanus toxin insensitive VAMP2 (synaptobrevin2), N-terminally-tagged with mCerulean, connected by a 4 amino acid linker. For mammalian cells, used with mCit-4aa-SNAP25B for FRET.DepositorInsertVAMP2 (Vamp2 Rat)
Tags4aa-linker and mCeruleanExpressionMammalianMutationMutated Q76 to V; F77 to W.Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-gusA
Plasmid#67036PurposePlasmid for Paph-gusA integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
gusA
UseConjugative bacterial vectorAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTS2410-Tier1-PhCMV-Myr_mTagBFP2
Plasmid#169535PurposeTier-1 vector encoding PhCMV-controlled plasma membrane-tethered mTagBFP2 (PhCMV-myr-mTagBFP2-pA).DepositorInsertPCMV-driven membrane-localized monomeric Tag blue fluorescent protein 2
ExpressionMammalianPromoterPhCMVAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENV8(GAAA)-GFPuv
Plasmid#70128PurposeNegative control cobalamin riboswitch reporter vector for use in E. coli; deletion of regulatory kissing loop interaction by conversion of L5 to GAAA tetra loopDepositorInsertkissing loop regulatory mutant of environmental cobalamin riboswitch sequence (env8)
UseSynthetic BiologyTagsNoneExpressionBacterialPromotertacAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-WT
Plasmid#136008PurposeWT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPW3783 : CMVd3-ERmembrane-GST-2xHaloTag-KKMP
Plasmid#185687PurposeLow-level transient expression of two tandem HaloTag proteins targeted to the ER membrane, fused with a GST for constitutive dimerization (making a HaloTag tetramer).DepositorInsertERmembrane-GST-2xHaloTag-KKMP
ExpressionMammalianAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW313lux-hrpR
Plasmid#61436PurposepBWF2620 encoding rbs33-hrpR-ter (pBWF2620: pSB3K3 carrying BBa_F2620 (PTet-rbs34-luxR-ter))DepositorInsertF2620-rbs33-hrpR-ter
ExpressionBacterialPromoterpluxAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
JAB2603
Plasmid#190390PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_5XAmtRO::GFPint-NLS-ADHt)DepositorInsertproUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_5XAmtRO::GFPint-NLS-ADHt
ExpressionPlantAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-mTq2
Plasmid#67031PurposePlasmid for Paph-mTurqoise2 integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
mTurqoise2
UseConjugative bacterial vectorAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) 6xHis-TEV-IFIT5
Plasmid#53560Purposebacterial expression of IFIT5DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS5
Plasmid#55750PurposeProduces one half (beta) of aminoglycoside phosphotransferase (3′)-IIa when in the presence of T7 RNA Polymerase.DepositorInsertKanR
ExpressionBacterialMutationResidues 59-264 of KanRPromoterT7-lacAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
IBMc071
Plasmid#161943PurposeContains Type IIS restriction site free elements for expressing protein to be split in IBM. ECF20 expression plasmidDepositorInsertpSB3T5(BsaI-)-PBAD(SapI-)-B33-ECF20-T
ExpressionBacterialPromoterPBADAvailable SinceMarch 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAB822
Plasmid#47856PurposeBIOFAB reporter plasmid for measuring BBa_B1006 termination efficiencyDepositorInsertBBa_B1006 terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO11Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB803
Plasmid#47847PurposeBIOFAB reporter plasmid for measuring T7 early termination efficiencyDepositorInsertT7 early terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO2Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
NLS-dCas9-HA-NLS-GFP4-VPR
Plasmid#183924PurposeVPR activation domain coupled to catalytically inactive dCas9 for localization; contains a GFP tetramer fpr labeling and as a spacerDepositorInsertdCas9-GFP4-VPR
UseCRISPRTagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEos2-CD151-7
Plasmid#57358PurposeLocalization: Tetraspanin/Membrane, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPyCAG-NE-EGFP-IRES-Pac
Plasmid#183617PurposeMammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered EGFP (NLS-EGFP-EmerinTMD). Confers puromycin resistance.DepositorInsertEGFP
TagsHuman EMD transmembrane domain and NLSExpressionMammalianPromoterCAGAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5B3-T
Plasmid#92021PurposeExpresses TALE targeted to lysA promoter with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lysA with N-terminal TEV protease cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-HcRed
Plasmid#67035PurposePlasmid for Paph-HcRed integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
HcRed
UseConjugative bacterial vectorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFE-vcDAB
Plasmid#133004PurposepFE carrying the vcdabA2 ( locus_tag: CSW01_RS07960) and vcdabB2 genes (locus_tag: CSW01_RS07955)DepositorInsertsvcdabB
vcdabA
ExpressionBacterialPromotertetRAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRD21A-mRFP
Plasmid#181959PurposeRD21A protein tagged with mRFP, under control of native promoterDepositorInsertRD21A genomic sequence including 2kb upstream of the ATG
TagsmRFPExpressionPlantPromoterRD21A nativeAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)
Plasmid#111255PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorT signal peptideDepositorInsertTorT signal peptide
ExpressionBacterialPromoterPcAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219V, C151AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[LacI-L]
Plasmid#60745PurposeContains PI driving expression dimeric LacI, the Lactose inducible repressor.DepositorInsertLacI
UseSynthetic BiologyExpressionBacterialMutationwt LacI without the tetramerization domainAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5A7-T
Plasmid#92020PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain and a second in the C-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N and C-terminal TEV protease cleavage sites
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5A3-T
Plasmid#92019PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N-terminal TEV cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL600
Plasmid#37563DepositorUseSynthetic BiologyExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only