We narrowed to 24,475 results for: crispr
-
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMS22: pHelper(PmcCAST)_entry_ΔTniQ
Plasmid#168155PurposeInducible expression of PmcCAST proteins (except TniQ). Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB, TnsC and TnsD)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-FCPF
Plasmid#220141PurposeExpresses Cas9-FCPF in mammalian cellsDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-TTF-1-gRNA
Plasmid#101857PurposeIntroducing a gRNA targeting human TTF-1 (NKX2-1) into cellsDepositorInsertgRNA targeting TTF-1 (NKX2-1 Human)
UseLentiviralAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgIREB2_2
Plasmid#169886PurposeDisrupt IREB2DepositorInsertsgRNA targeting IREB2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIF1079
Plasmid#237445PurposeExpression SpCas9 and Efe1-RT from bidirectional CAG promoters. SpCas9 sgRNA and Efe1 non-coding expression is driven by U6 and H1 respecitvely.DepositorInsertsSpCas9
Efe1-RT
EMX1 sgRNA
Efe1-ncRNA targeting EMX1
Tags3xFLAGExpressionMammalianPromoterCAG, H1, and U6Available SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75236PurposeCRISPR/Cas9 plasmid against human NFATc1DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgSp1
Plasmid#174907PurposeSecond generation sgRNA against Sp1DepositorInsertSpecificity Protein 1 (SP1 Human)
ExpressionMammalianMutationMissense mutation to mutate PAM sequencePromoterEFS-NSAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro PRMT5-CRISPRi
Plasmid#164637PurposelentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2DepositorInserttarget guide sequence PRMT5 inhibition (PRMT5 Human)
UseCRISPR and Lentiviral; InterferenceExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-7SK-Blast
Plasmid#183620PurposelentiCRISPRv2 derivative with modified 7SK promoter driving sgRNA and encoding Blasticidin resistance. Compatible with inserts designed for lentiCRISPRv2.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterModified 7SKAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only