We narrowed to 24,475 results for: crispr
-
Plasmid#173696PurposeA knockout vector for the dog Nrg1.DepositorInsertA gRNA targeting the dog Nrg1 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEreg
Plasmid#173697PurposeA knockout vector for the dog Ereg.DepositorInsertA gRNA targeting the dog Ereg gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTgfa
Plasmid#173698PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dHbegf
Plasmid#173699PurposeA knockout vector for the dog Hbegf.DepositorInsertA gRNA targeting the dog Hbegf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-bleo-dEgf
Plasmid#173840PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-puro-dHbegf
Plasmid#173841PurposeA knockout vector for the dog Hbegf.DepositorInsertA gRNA targeting the dog Hbegf gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-dEreg
Plasmid#173843PurposeA knockout vector for the dog Ereg.DepositorInsertA gRNA targeting the dog Ereg gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4566
Plasmid#88904PurposeExpresses MbCpf1 crRNA and inactive/dead, humanized MbCpf1 nucleaseDepositorInsertsMb crRNA
hMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAaePUb::Cas9-2A-Neo
Plasmid#176680PurposeExpression of Drosophila codon optimized spCas9 under Ae. aegypti Polyubiquitin promoter (AAEL003888)DepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS2701-CMV-Nme2Smu-ABE8e-nt-E932R
Plasmid#228722PurposeExpresses N-terminal ABE8e-Nme2Smu nCas9 (D16A) base editor with E932R mutation in mammalian cellsDepositorInsertN-terminal ABE8e with Nme2Smu nCas9 (D16A) E932R
UseCRISPRExpressionMammalianMutationNme2-Cas9, Smu PID, D16A E932RPromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS1: pHelper(AvCAST)_AvPSP1
Plasmid#168133PurposeInducible expression of AvCAST proteins with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa-Theo-1
Plasmid#240207PurposeBacterial CRISPRa vector expressing dCas9, MCP-SoxS, and a theophylline-responsive MR-scRNADepositorInsertsdCas9
MCP-SoxS
Theophylline MR-scRNA variant 1
UseCRISPRExpressionBacterialPromoterJ23107, J23119, and Sp.pCas9Available SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa-Trp
Plasmid#240209PurposeBacterial CRISPRa vector expressing dCas9, MCP-SoxS, and a tryptophan-responsive MR-scRNADepositorInsertsdCas9
MCP-SoxS
Tryptophan MR-scRNA
UseCRISPRExpressionBacterialPromoterJ23107, J23119, and Sp.pCas9Available SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only