We narrowed to 17,391 results for: puro
-
Plasmid#13583DepositorInsertintegrin beta 6 777T (ITGB6 Human)
UseRetroviralTagsExpressionMammalianMutation777T. Lacks last 11 amino acids of cytoplasmic do…PromoterAvailable sinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup93-SpeI
Plasmid#87331PurposeExpression of shRNA targeting at Nup93DepositorInsertshRNA against human Nup93
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceJune 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -126
Plasmid#50924PurposeU6 driven sgRNA targeting Sox17 -126 bp from TSSDepositorInsertSox17 -126 sgRNA (SOX17 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-FLAG-Neuroserpin oloop
Plasmid#58262PurposeRetroviral vector for expressing mutated Neuroserpin in mammalian cellsDepositorInsertNeuroserpin (SERPINI1 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationMutant of neuroserpin lacking five residues from …PromoterAvailable sinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup88-HindIII
Plasmid#87329PurposeTo express shRNA against human Nup88DepositorInsertshRNA against human Nup88
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorInsertSox17-296 sgRNA (SOX17 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-R66A
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorInsertRac1 (RAC1 Human)
UseLentiviralTagsExpressionMutationR66APromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorInsertRac1 (RAC1 Human)
UseLentiviralTagsExpressionMutationY64FPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorInsertCHMP2B-targeted sgRNA (CHMP2B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR
Plasmid#215377PurposeLentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control.DepositorInsertmNeonGreen-3K-1-10
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-mNeon-Puro
Plasmid#239955PurposeLentiviral vector to generate mNeon-tagged MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6-mNeon
UseLentiviralTagsmNeonExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
UseTagsiRFP713ExpressionMammalianMutationPromoterCAG promoterAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:OsAID:3Ty (p5229)
Plasmid#239361PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagExpressionMutationPromoternoneAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SV40-puro-EF1a-HA-NLGN1dAChE-bc
Plasmid#220437PurposeExpresses HA-tagged human NLGN1 with K578A/V579A substitutionsDepositorInsertNeuroligin-1 (NLGN1 Human)
UseLentiviralTagsHA-tagExpressionMammalianMutationK578A and V579A substitutionsPromoterEF1aAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only