We narrowed to 10,180 results for: yeast
-
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTH375-SUP45-P174Q
Plasmid#29383DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationP174Q mutant gene including genomic sequence 1432…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
BB3aK_14*
Plasmid#98529Purposeempty BB3 for insertion and overexpression of 1 gene in P. pastorisDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
GTL-y
Plasmid#81100PurposeGene Tagging vector LEU/YFP - Plasmid for monomeric Citrine (mCitrine) labeling of endogenous proteins with a LEU selection marker, originating from pSIVl (ID:81090)DepositorInsertmCitrine
UseCre/LoxTagsmCitrineExpressionYeastMutationMutated mCitrine for monomeric isoform (A206K L22…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJT79_GalL_nCDA1Δ192-BE3
Plasmid#145045PurposeExpresses nCDA1Δ192-BE3 in yeast cellsDepositorInsertnCDA1Δ192-BE3
UseCRISPRExpressionYeastMutationpmCDA1(1-192AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
ZJOM8
Plasmid#133671PurposeIntegration of SNF7-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Present on endosomes and vacuolar surface.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNB785
Plasmid#60164PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by SIC1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterSIC1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD8
Plasmid#112820PurposepSMF2 with 8 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD10
Plasmid#112821PurposepSMF2 with 10 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
BB3rN_AH
Plasmid#98556Purposeempty BB3 for insertion and overexpression of 7 genes in P. pastorisDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNB787
Plasmid#60152PurposeFirefly luciferase (Promega) and yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by LEU1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterLEU1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNB789
Plasmid#60166PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by RNR1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterRNR1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
GTL-ir
Plasmid#81102PurposeGene Tagging vector LEU/iRFP - Plasmid for tandem infrared RFP (tdiRFP) labeling of endogenous proteins with a LEU selection marker, originating from pSIVl (ID:81090)DepositorInserttdiRFP
UseCre/LoxTagstdiRFPExpressionYeastMutationcodon optimized second iRFP to avoid internal rec…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
GTT-y
Plasmid#81110PurposeGene Tagging vector TRP/YFP - Plasmid for monomeric Citrine (mCitrine) labeling of endogenous proteins with a TRP selection marker, originating from pSIVt (ID:81092)DepositorInsertmCitrine
UseCre/LoxTagsmCitrineExpressionYeastMutationMutated mCitrine for monomeric isoform (A206K L22…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP (F64L, S65T, V163A)-His3MX6
Plasmid#53185Purposechromosomal tagging with stable GFPDepositorAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN103
Plasmid#233860PurposeMoClo-YTK; ConLS/R1 cassette; NS3 systems; pTDH3-LexA-NES-NS3-V1-NLS-VP48-2XOaf1-tADH1DepositorInsertpTDH3-LexA-NES-NS3-V1-NLS-VP48-2XOaf1-tADH1
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN104
Plasmid#233861PurposeMoClo-YTK; ConLS/R1 cassette; NS3 systems; pTDH3-LexA-NES-NS3-V2-NLS-VP48-2XOaf1-tADH1DepositorInsertpTDH3-LexA-NES-NS3-V2-NLS-VP48-2XOaf1-tADH1
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAL007
Plasmid#233866PurposeMoClo-YTK URA multigene plasmid with MCS; NS3 systems; pTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2DepositorInsertpTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI277
Plasmid#228285PurposeConstitutive EGFP expressionDepositorInsertEGFP
UseSynthetic BiologyExpressionYeastPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWR88
Plasmid#203422Purposeempty BLINCAR plasmid for payload delivery, no payload, no genomic targetDepositorInsertsCAR copy 1
P(TEF1)/coKanMX/T(ACT1) + P(TDH3)/coCBG/T(ADH2)
CAR copy 2
ExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR23
Plasmid#202770Purposeepisomal bioluminescent reporter plasmid for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coKanMX
ACT1 terminator (S. stipitis)
TDH3 promoter (S. stipitis)
coCBG
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
ExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR10
Plasmid#202710Purposeepisomal bioluminescent reporter plasmid for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coShBle
ACT1 terminator (S. stipitis)
TDH3 promoter (S. stipitis)
coCBG
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
ExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR9
Plasmid#202645Purposeepisomal bioluminescent reporter plasmid for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
TDH3 promoter (S. stipitis)
coCBG
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
ExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
IAA17-4flag-HIS5
Plasmid#207015PurposeFor ORF tagging with IAA17-4Flag. IAA17 is an auxin-inducible degron (AID).DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only